Dataset for CDS Unclassified of Organism Ixodes scapularis

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|B7PQ11_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Ixodes scapularis (length=381 residues).
atgaagacggtgacgggcaacatcggcctgcacgcgctcccctcggagacggccgtccagaacgtcttcgaagccgtggc
gcgagagctgttccgcaacgacatctcctggggccgcatcgtggcgctgtactcggtgtccggagggctggccgtggact
gcgtcaagctgggacaccccgagtacgtcctggccctggtccaggcgctgggactcttcgtcgagcgggacctggcttcc
tggatcagccaacaaggcggatggtcaaccctcgtcacgaggttccgcaagcaacccaagcgttccatcatcatagactt
catcttcctcctgggcggtctactggccctggtgctgctagtctactactggctttcttga
>gnl|bcl2dbcds|B7QGH7_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Ixodes scapularis (length=2046 residues).
atggcgcgaaagatcgtcgaagtccaagcgtccggagacgcagcggccgccagcggtagcgcgggagcgccgcaacagcc
ccggcccaacctgctgccgctgcagacgcacctgagcattccgctgctgctgccgactccgacccgcgaagagactgagg
aagaggggcgcgtgctgctgagcaccttcattgactaccaagtggcgcaggagggcatggagcaccccgaggccttgggg
gacatggtgtactcgcaaaccctggagggggtcgaggcagcccaggcaccccctagccgcgaggaggttcttctcgcaca
ccccgtataccgccgcgtgggccgggagctgcgggacctggcggagcgcttctcgtacagccccgagcgcagccgggtgc
gccaggaggcggacgccctggacctgtcgaccctgacccgggagaacctgaacagcctgatgctggagctgttccacgac
ggcttcagcagggagcgcctggtcactttcttcttcttctgcagcgacctgatcctcagggccctgcgcacgtccctggg
cgcctgcctgcgtatgcaggtagtcctctgggtctgggccttcctcagggacaacgtctgcgactgggtgcttcagaggg
gtggctgggaggtggtgctcaccagctacctgcctagtcttgttgtgaccgctgcaggcgtcgccgtctgtgccgctgcc
attttctacatctggaagaactgtgagctggtggcggaggaaacgtgggtgtcggtgcaggccatctccgagaggctcgt
cgcggaaccgctgactgccgtagtgtgccggctgtcggccgagctcttccgtttcctgcggaatgccttcgccggagacc
ccgcaaactccgaaaccgcccttagccgcaggaagctgctgcagaatgtggactacttgatcagagccctgatggaacag
cgctccaaagaacccaccgacgaagaggccactgtggccttgcggtgtggactgcagtgcttcggcaacttggtggccag
ctgggaagcttcccgagagcttgtctggaacctcactttcctgtggagcacgccaatctacccagccctgctgtccagcg
acgacgccaccctgaggatgtacgccagcatgttgctgcacggctgcctcctcaagggggcgctgctgcggctcttcttc
tggtccccgtgcacggctgaagtggtcacgtgcctgacccagatgatggccgacgtcgagtccgaatggagcctgttctt
gctcgagatgtttctgacgcacgagaactcgccagtcatcttcggcaagctgccccggcaggcacgctgggtggtactcg
acgtcgccgtggaacaggtgcagaagaaggacggccaggcggtgcatgccgacttcttggaccacctgtgtgccttcctg
cagagggagttcgaggacgtcgtggccgtgccccattgcatcgacgaagggaagctggagccgatccagatcagcaagat
gctgaacgtgctgtgcgaggcgtcttgcaatgagaacttctctcagctgatcgaaccgaagcaggggctgctgaaggcga
cattaggtgttctcaaggttgtacacttgttgggcaagtccggcaacaatgcgttcacgcccgcccccaagctggacgac
cttgtgaaggccgaggaagccgactcggacgtggacccgcgcaggaacttcaagaaggagctcgtccgtctggttggcaa
catgagccaccactccagggccaaccaggacctggtcaggcaggtcgaaggaattgctttactgctggatgtctgcaatt
tggatgccaagaatccatacatcattcagtgggtagttctggccatcaggaacctgctggagaacaaccccaagaaccag
gaagttgttgcgggcttggttaacaagggaatagtcacggacgcccctcaattgcaggagctcggcatcagcctcgatct
gctttcgctgaccagagaagggatgtctcccggccgccccgaatga
© 1998-2018