Dataset for CDS BOK of Organism Ictidomys tridecemlineatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|I3N6F3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BOK (length=522 residues).
ctgcctcttccagctgggctgagggccactccaggacattccttgtcctccccagagcctgccagccctctgggacgtgc
tgacctcttgtgtgcctatgcaggggatgagctggagcagatccggcccagtgtgtaccgcaatgtggccggccagctgc
acctctccgtgcagtcggagcccgtggtgacagatgcattcctggctgtggcaggccacatcttctctgcaggcatcacg
tggggcaaagtggtgtccctgtacgcagtggctgcaggactggctgtggactgtgtgcggcaggcccagcccgccatggt
ccacgccctggtggactgcctgggggagtttgtgcgcaagaccctggcagcctggctgaggcggcgtggtggatggactg
atgtcctcagatgcgtggtcagcacggaccctggcctccgtgcacactggctggtggctgcgctctgcagttttggccgc
ttcctgaaggctgcctttttcatgctgctgccggagagatga
© 1998-2018