Dataset for CDS BAX of Organism Ictidomys tridecemlineatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|I3MM08_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggaggcgggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcaggtcggatggggggggacacatcagagctggccttggagcaggtgccccaggatg
cttccaccaagaagctgagcgagtgtctgaagcgcatcggtgatgaactagacagtaacatggagcttcagaggatgatt
gcagctgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgtttgctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgccagagctgatca
gaaccatcatgggctggacgctggacttcctccgagagcggctactgggctggattcaagatcagggtggttgggatggc
ctcctctcctactttgggacccccacgtggcagacagtgaccatctttgtggccggagtgctcaccgcctctctcaccat
ctggaagaagatgggttga
>gnl|bcl2dbcds|I3MM08_BAX-02 BCL2-associated X gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAX (length=222 residues).
atggacgggtccggggagcagcccagaggaggcgggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgcagctgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgtttgctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
© 1998-2018