Dataset for CDS BAK1 of Organism Ictidomys tridecemlineatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A287D718_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAK1 (length=453 residues).
atggcatccgggcaaggcccaggtcctcccagtgaggaatgtggagagccagcctccgattctgagcagcaggtagtcca
ggacacggaggaggtttttcgtagctacgtttattaccgtcaccggcaggagcaggaggctgagggagcagctgcccctg
ctgacccagagatggtcttggccctagaacctaccagtaccatggggcaggtgggtcggcagctcgctgtgattggtgac
gacatcaaccggcgctacgactctgagttccagagcatgcttgaacaactgcaacctacagctgcgaatgcctatgaact
cttcaccaagatcgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccgtgtggtggc
tctcctgggctttggctatcgcctggccttacacgtctaccggcatggcctga
>gnl|bcl2dbcds|A0A287D718_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAK1 (length=627 residues).
atggcatccgggcaaggcccaggtcctcccagtgaggaatgtggagagccagcctccgattctgagcagcaggtagtcca
ggacacggaggaggtttttcgtagctacgtttattaccgtcaccggcaggagcaggaggctgagggagcagctgcccctg
ctgacccagagatggtcttggccctagaacctaccagtaccatggggcaggtgggtcggcagctcgctgtgattggtgac
gacatcaaccggcgctacgactctgagttccagagcatgcttgaacaactgcaacctacagctgcgaatgcctatgaact
cttcaccaagatcgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctctcctgggctttggctatc
gcctggccttacacgtctaccggcatggcctgacaggcttcctgggccaggtgacccactttgtggtcgacttcatgttg
catcgctgcattgcccggtggatcgcacagagaggaggctgggtggccgccctggacttgggcaacggcccaatccggaa
tgtgctggtggttctggctgtggttctgctgggccagtttgtggtacgaagattcttcaagtcatga
© 1998-2018