Dataset for CDS BAX-like of Organism Ictalurus punctatus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2D0RSQ3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ictalurus punctatus GN=BAX (length=609 residues).
atggcagattcacatggcaacgacaggacggacgacactgaaggtgcaacaggtggtgaagatgtgattgatgataggat
catggaagaaggtgccctagtactaagaggatatgtaatcgagcggatcactacagaggacccggacatgcacgtcagcg
ccgtggacctcggaggaacagctagtgaaggagatgatcctcatgttaaagaagttgtagatcagcttctcaagatcgca
gatgagctgaaccggaatgcagagcttcaacacctcatcaacactgtgcaggcgaactgtgctcaggaggtgttcacgac
tgtggccaagagcatcttttcagacggcattaactgggggcgaatagtggctctctttcatctggcctatcggctcattt
acaaggcactgactcaaaaccactttgaaatcatcaagaacatcattagctgggtattgcagtttatcagggaacacatt
tccgcctggatcagacaacaaggaggatggggtggtgttatccgcagtgtgtcaagatggcgctccgtgtccatcattgc
agcagtggcgttcatagctgctgccgtatactggagaagaactcgttga
>gnl|bcl2dbcds|A0A2D0RZ44_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ictalurus punctatus GN=BOK (length=645 residues).
atgaagggcatggagatgctccgtcgctcgtcagtgtttgcagcagaagtcatggaagtgtttgaccgctccccaacaga
caaagaactcatctcccaatcgaaaatgttgtgcagggactacattcactcaaggctcaaccgggctgggattggttgga
ccaaatccgagcttggatctacaggaggaaccctcggagaagtgtccactgttcttctttggttaggtgatgagcttgaa
tacttgcgacccaacgtgtaccgcaatgtggcaaaacaactgaatatcactgtggcttcagaaggtattgtttctgatgc
ctttctggctgtagctgcagaaatcttctccacaggggtgacgtggggtaaggttgtctctctgtatgcagtagccggag
cattggcagtggactgtgttcggcatggctaccctgccatggtccacaccatcgtagactgcatgggcgagtttgttcgc
aagagcctggtgtcctggttaaagaggagaggaggttgggctgacattacaaagtgtgtagtgaacacggaccccagctt
ccattctcactggctggtggcagcagcctgtacgtgtgcacactacctgaaggccatcgtcttctacctgctgagggaga
agtga
>gnl|bcl2dbcds|A0A2D0SVX0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ictalurus punctatus GN=BOK (length=594 residues).
atggaggcgttggagcaaattcccacggaaagtgagttggttctccaggcgaaactgctgtgcagggagttcatgtactc
cagaataactcgggaaggactgagctggtgtcgagtggaagccgctccacctgcagctcctgcagctctcacacacgcag
cactggtgctcctcaagctgggtgacgaacttgagaacatgaggcctaatgtttatcgaaacatcgccaagcagctgaat
atctcggtgacgatggaggctgtggtgtcggacgcgtttctgtatgtagcgactgaaatcctctccctcgggatcacatg
ggggaaagtggtggccatctttgcggtggctggtggtctggcggtggactgtgtgcgacaggagcgtgcggctgtagtgc
acactatagaggaaagtctaggggagtttgtgaggaagagcctagtgccctggctcaggaggagaggaggatggggtgac
attttgaagtgtgtgaggaacgtagagaaccgcactcaaacacactggacctcatcagtcatactgacctggagacacct
tttgaatatgatctatatctacctgataaagtaa
>gnl|bcl2dbcds|E3TFZ1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ictalurus punctatus GN=BAX (length=570 residues).
atggcatcaggagaaggcgatggcaccagcaatgaccaaatattagaagtaggagctgtgctgctgaaggatttcattta
tgagcgagttcatcgtcatggggacagcggcaccgttgtatcgcggcacgaactgggcgggagcgagctctgcgacccca
cccataaaaaactcgctcagtacttacagcagattggagatgagctggacaacaacgtagacctacagagaatgttagcc
gactcagctctccagccaactaaagaagtgtttgtgaaggtggcgcgtgagattttctcggatgggaagtttaactgggg
cagagtggtggcacttttctactttgcttgtcgacttgtgatcgaggctctcctgacgaaaattccagacatcatcagaa
ccatcatcaactggactctggactacctgcgggaacatgtgattaattggattagggaacagggaggctgggaggggatc
cagacctactttggcacaccgacctggaagaccgtcggcgtctttctggctggagttctcaccactgtcctggtcatgcg
caagatgtga
© 1998-2019