Dataset for CDS BAX of Organism Ictalurus punctatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E3TFZ1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ictalurus punctatus GN=BAX (length=570 residues).
atggcatcaggagaaggcgatggcaccagcaatgaccaaatattagaagtaggagctgtgctgctgaaggatttcattta
tgagcgagttcatcgtcatggggacagcggcaccgttgtatcgcggcacgaactgggcgggagcgagctctgcgacccca
cccataaaaaactcgctcagtacttacagcagattggagatgagctggacaacaacgtagacctacagagaatgttagcc
gactcagctctccagccaactaaagaagtgtttgtgaaggtggcgcgtgagattttctcggatgggaagtttaactgggg
cagagtggtggcacttttctactttgcttgtcgacttgtgatcgaggctctcctgacgaaaattccagacatcatcagaa
ccatcatcaactggactctggactacctgcgggaacatgtgattaattggattagggaacagggaggctgggaggggatc
cagacctactttggcacaccgacctggaagaccgtcggcgtctttctggctggagttctcaccactgtcctggtcatgcg
caagatgtga
© 1998-2018