Dataset for CDS BAX-like of Organism Ictalurus furcatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E3TCT7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ictalurus furcatus GN=BAX (length=609 residues).
atggcagattcacatggcaacgacaggacggacgacactgaaggtgcaacaggtggtgaagatgtgattgatgataggat
catggaagaaggtgctctagtactaagaggatatgtaatcgagcggatcactacagaggacccggacatgcacgtcagcg
ccgtggacctcggaggaacagctagtgaaggagatgatcctcatgtcaaagaagttgtagatcagcttctcaagatcgca
gatgagctgaaccggaatgcagagcttcaacacctcatcaacactgtgcaggcgaactgtgctcaggaggtgttcacgac
tgtggccaagagcatcttttcagacggcattaactgggggcgaatagtggctctctttcatctggcctatcggctcattt
acaaggcactgactcaaaaccactttgaaatcatcaagaacatcattagctgggtattgcagtttatcagggaacacatt
tccgcctggatcagacaacaaggaggatggggtggtgttatccgcagtgtgtcaagatggcgctccgtgtccatcattgc
agcagtggcgttcatagcggctgccgtttactggagaagaactcgctga
© 1998-2018