Dataset for CDS Unclassified of Organism Hydra vulgaris

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A1E3K6_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hydra vulgaris (length=693 residues).
atgaaagatcctatgatggcgagatttatgaatgaatgttgcgagattaataataacaactcacctgattacaattatat
aaactacgatgcaaatgacacggtagagcaagattttttgagatcgatagaagacgacacagaaaaacaccgcggtttca
ttcgaaaacttgctaatgaccacatacattataaactgtttggtaaaggaactataaacatatgcgatacagatataaaa
atgaacccttttgaaaaaaaactcacaacaacagtcgttacattacgtcgtgtcagtagtgagctagaagatatgcatat
tgatttttttgaaaatgtatgccatgcaattaacgaagaaaacgcgggtgaagttttcaatgaagtttcgcaaaaggttt
tgactgatgacaatttaaattggggacgggttgttagtttaattacatttggtggaaagttagctcaatggttttgggct
agacaaccaaataatgaactgattgaagaaatcgaggattggttaaccgaaagcttatcagataaaaaagactggattaa
acaaaaaggaggctgggacgatttcaatcgcacatttacaaagccagcacaaaacacatggtggaaaactagcctttggg
ttggattaagcgcatctctagcggcagcatttgttatgaaatcgctaaggtaa
>gnl|bcl2dbcds|A7LM81_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hydra vulgaris (length=1038 residues).
atggcgagatatgtaaatagtagttgcgagacaaacaacaacacgacagatcacaattataatcactacgatactaggga
catagtagaacaagattattttagatcgatagaagacaacacagaaaaacaccgcggtttcattcgaaagcttgctaatg
accatatacattataaactgtttggtaagggaattataaacatatgcgatgacgacattaaaatgaatccttttgaaaaa
aaactcacaacgacggccgttacgttgcgccgcgtcagtagtgagttggaagatatgcatattgatttttttaaaaatgt
atgtcacgcaataaacgaagaaaacgtcggtgaagttttcaacgaagtttcgcaagaggttttggctgatgacaatttaa
attggggacgagttgtaagtttaataacgtttggtggaaagctagctcaatggttttgggctagacagcctaataatgaa
ttgattgaagagatcgaggactggttaaccgaaagtttatcagataaaaaagactggattattgaaaaaggaggctggga
caactttaatcgcacatttacaaaaccagtacaaagcacatggtggaaaactagcttatgggttgggttgagcgcatctt
tagtggcagcattagctatgaaatttctgagacgattaagagagattacggaagaatttattaaacactttgtgtcttgg
gtacgcgttgtccgtggcccagacagtacacgactccgggccagaactctggcgaattatcgcacgccattgcgactata
tttgtcacgggccattactggcgcgattctggcaagcgactcgagcaattttttatgtacggtaaatcatcgtggtgtta
aagctaatgatgtagatatttcactaaacacaattagaagagcacgagcatcgtctgaagaggttgaacgttggctaaaa
agatattttcagcttttcagtgatcgaaatggcggccgtaaagctcgggaagaacttaaaatttccttccaaaaataa
© 1998-2018