Dataset for CDS BAK1 of Organism Hydra vulgaris

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A1E3K5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Hydra vulgaris GN=BAK1 (length=663 residues).
atggcagaagcagctgatgatcttcataagcaagaagaacaacaagtagctaatgatacagaaaaagttttttgcagctt
tgtctacaaacgtttaactagtgaaatcgacaaagagtcctcagacggcagtcttgaagttggcaatgtcattactaacc
tacgtagtgaagtaacagaatttagaaatgttgatgagagtaatggagaaacagaaaatcttggtagagtcttagcttca
tttggtgatgaaataaatgataaatacagacaagtgttttcagatatgttatgtcgcttgaacattgaaacagaagatgt
tgcttatgagacttttgctaacattgcaagacgtctttttgaaaatggtattaattgggggcgtattgtagctcttttgt
gttttggctatgaagttgcatttgcaattattaagcgaaatgcgcgtgggtttggaaaatttttgcgcaaattgattcgt
tttgtggttgattttattgtgaatgaaaagatagcaaagtggattgccaaaaacggaggttggctggctgctcttgttgg
tttaaagaaagtagatgacagttctgatgtatggtttaaaagaatcgtgattctaggatctagcaatgctacagtttata
tgatacaccgtagaacacgttag
>gnl|bcl2dbcds|A7LM76_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Hydra vulgaris GN=BAK1 (length=762 residues).
atggctgaacatgaatgcaatggtagctctgatgacttagttcagttaactaaaacagctgaaaacatagtacggtgttt
tatatatcgaatgctagaaaaagttataaataaatcctcttgtgaagaaaactttcgattgcatttttctttacttcctg
aacctgttctttgtgagataagagctgttaaagaatatctgcgtaaatgtgaaagttcttactcaactgaaaaagattcc
tggtttatacacaaggcagttcaaattcttgaggagcaaggtggcatagcaattcaaaaatatcatcatgcgtttcttag
tttaattaatcagttacaaataacagatgaatataattttgcttatactcagtttgttgaagttgctaaaaaactttttg
agaatgacaacattgcatggagtcatattgtttccttgatatgttttggtgtagaaatttctgtttacatagtcgagcat
ggcaaagtagggcttgcatcatttttaaaaaagatatgcagttttattgtggactttattgtaaaagaagaaattttgca
gtggattgcacaacatggtggatggattaaaatgattgatttttttgatgatccaaactgtcagtttcgtactaatcata
tcttggccgctatggcaatatctgaactaactaatattgaagtatggcttcaacgtttttttgtggcttcactggtttca
ggaataattgttattgcttggagaaaatggcatcaaccctaa
© 1998-2018