Dataset for CDS BOK of Organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|Q9UL32_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Homo sapiens GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctggcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccctctgcagtctgagcctgtggtgactgatgcctt
cctcgctgtggccggccacatcttctcagcaggtatcacatggggcaaggtagtgtccctgtactcggcggctgcgggac
tagcggtggactgcgtccggcaagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
accttggctacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtcagcacaaaacctggcttccg
ctcccactggctcgtggccacactctgcagctttggccgcttcctgaaggctgcattcttcctcctgttgccagagagat
ga
>gnl|bcl2dbcds|Q9UMX3_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Homo sapiens GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcctggagcgcgcccg
agcgtgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaagacc
ctggcaacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctc
ccactggctggtggctgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018