Dataset for CDS BAX of Organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A0C4MVT1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=615 residues).
atggacgggtccggggagcagcccagaggcggggtttcatccaggatcgagcagggcgaatgggggggggaggcacccga
gctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactgg
acagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagct
gacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggc
cctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggct
ggatccaagaccagggtggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtctccaggacggcct
cctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatct
ggaagaagatgggctgaggcccccagctgccttggactgtgtttttcctccataa
>gnl|bcl2dbcds|A0A0C4MW46_BAX-01 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=528 residues).
atggacgggtccggggagcagcccagaggcggggtttcatccaggatcgagcagggcgaatgggggggggaggcacccga
gctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactgg
acagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagct
gacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggc
cctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggct
ggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtg
gcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A0C4MWS3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=615 residues).
atggacgggtccggggagcagcccagaggcggggggtttcatccaggatcgagcagggcgaatgggggggaggcacccga
gctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactgg
acagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagct
gacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggc
cctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggct
ggatccaagaccagggtggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtctccaggacggcct
cctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatct
ggaagaagatgggctgaggcccccagctgccttggactgtgtttttcctccataa
>gnl|bcl2dbcds|I6LPK7_BAX-10 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=657 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaagcctcctcacccccaccaccgcgccctcaccaccgcccctgccccaccgtccctgccccccgccactcctct
gggaccctgggccttctggagcaggtcacagtggtgccctctccccatcttcagatcatcagatgtggtctataatgcgt
tttccttacgtgtctga
>gnl|bcl2dbcds|I6LPK7_BAX-03 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|I6LPK7_BAX-05 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=126 residues).
atggacgggtccggggagcagcccagaggcggggtttcatccaggatcgagcagggcgaatggggggggaggcacccgag
ctggccctggacccggtgcctcaggatgcgtccaccaagaagctga
>gnl|bcl2dbcds|I6LPK7_BAX-06 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=495 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggctggcgtgaaatggcgtgatctgggctcac
tgcaacctctgcctcctgggttcaagcgattcacctgcctcagcatcccaaggagctgggattacaggccctgtgcacca
aggtgccggaactga
>gnl|bcl2dbcds|I6LPK7_BAX-07 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=540 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttggaccgtg
accatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|I6LPK7_BAX-08 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtg
ccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccg
cctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|I6LPK7_BAX-14 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=528 residues).
atggacgggtccggggagcagcccagaggcgggggttttcatccaggatcgagcagggcgaatgggggggaggcacccga
gctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactgg
acagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagct
gacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggc
cctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggct
ggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtg
gcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|I6LPK7_BAX-13 BCL2-associated X gene OS=[Eukaryota] Homo sapiens GN=BAX (length=423 residues).
atgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaactt
caactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaac
tgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgg
gtgagactcctcaagcctcctcacccccaccaccgcgccctcaccaccgcccctgccccaccgtccctgccccccgccac
tcctctgggaccctgggccttctggagcaggtcacagtggtgccctctccccatcttcagatcatcagatgtggtctata
atgcgttttccttacgtgtctga
© 1998-2018