Dataset for CDS Unclassified of Organism Helobdella robusta

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|T1FK63_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Helobdella robusta (length=1131 residues).
atggataacgattcgtcaccaaacattccaaagaagcctcccacaccgcaaaccccttcaggcagacttttaaaaatccc
catagcaccgacttttgcacaaaagacagtcacgtggttaaaaaagttgaagatgacccttaaatacgacccgttggcag
ttttcgggctgtccaataagtcccccattgaactggctgatatccgggaacaaggcagaataatcttcgaagacttcatc
tacatccgtctgaaagaagccgcgtttggtctggagcagaatagtgacgacgacgacgacgacgatgacgtgaaagatga
ccaacatggcggctgtgatgacgtcagacgcagcattctggagcgctctatctctagaaaagtaagagagaaaactcgaa
aaaattccttcctcgtctcgagttcatctctgaatatttctacaaaaggaggtaacttgaagttgggtaaaaataaatcg
atgtccggcttgagtgctggcaacattatcggtaacaatgcaaagttaccgaccggttttagtaacggctttcgttcaga
gttcggtagcctaccgacccccaccacttccggggacagcgacggaccgattaaaaaatcaatatggcagctcggagccg
gaagtgagttcgagaactggcacaacagtcacgtgactacgctgtgtgacgtcagcagggaaatgcatgccattggtctg
aagttggagaccatgtatcctagcttgtacaagaacgtatcggggcgcgcccataccaacatcaggaacgaatcacagtg
caggaaacttgtgacgtcatttggtgatttcatgtttaaaaatggagtcgtcacttggggcagaatagtagccatgtttg
ttctttcatcttcgctgatcgttgaatgctgccaaaacggcgacttccggtttataaaaactgtcatggcggctcattca
gaagtactagaaaagcacgtgatcaactggattgcggagcaaggaggatggggtattttgaccaaaacatttcgtgaagt
gacccaagaaactagaacgctgtgggccctactgggcttgggggcttctgtggggtttgccgtcatgtgggtggccatgg
aacagttatga
>gnl|bcl2dbcds|T1FPZ3_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Helobdella robusta (length=834 residues).
atgaaatctttaaaaccaaaattggcctggaccaagcagcttgtcctcgataacaaaaccacattcatagagtctaacat
aggtttcttgaagggacagtcttacaaagtcaaaagattcgccgaaaaaggacttgcctcgctagccaacgcagaaattt
cagcaaaagctatcaatgaagtcgtcgaacaatacaaccccaaattttcgtcaccgtcgtcatcatcatcatctccaacc
acgccaactgcgaatgacgtcagcgatgacgtcttcactcgacaacttggtagaatttatgtggccgcatctccaaactc
atcaaccgagtactcgtcaccggataaaatcggacaaattcgatacgaaaaatggcgcaaccgactaacggaagtttcta
ctgaaattcaatcgctaggtctgcgcctggagcaagcctatccctatctttacgataacttggcccatcagcttaaaatg
ccgctgagatcatcaatagctatcgagaaagctatgaccgccattggcgattacatattcaagaactcagtgatcacgtg
gtatcgaatcgttggactctttgctgtggccggagccgtggctctcgaatgcgtcgataacttcaaaggtccattgattc
caagcattgtgagcgtcttctcgcagatcattgagaggcacgtggctcgctggatatgcggagaaggtggatggattgca
ctgttgagcgagtacaaacccggtactcgaaagtacttgagactcgtcaggtacctcggagtattcgtcggtttcctgtc
ggtaatgtggctgccgtttcggttttatagttga
>gnl|bcl2dbcds|T1G8R2_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Helobdella robusta (length=240 residues).
ctgttcagtgatggcacgataagctggggacgaataacgattcttttccttttcggttacagaatcgccatatcggttct
ccgcaccggcttcagtcagatgattgagaagttcgtggcgtgtctggtcgaagtgatcattcgtgaaaagataactacgt
ggattgcacaacagggcggatgggttagcgcttctgtttatatcactcattatttctacccgtggtggctcagtagttag
© 1998-2018