Dataset for CDS BAK1 of Organism Helobdella robusta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|T1G3V4_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Helobdella robusta GN=BAK1 (length=594 residues).
atgattgttagaccggacacagaagctgagataagacctgacacagaagaaaatgttgtcaatcagacggatggaatatt
taggagttttgtcacaaatatgtatgttcatgataggctatctagcactgctgacgagtcaccgaggttcggagagttga
tgctcggggccccagagaatcctttgtctcgagcctctgagataggcagaaggctggctcagattggagatacagtcaac
gaaaggtattcatctgagttcaacgaaatgattaagatgcttaatccaactcccgaaactgcctttgaagctttctccaa
tgttgctgagagacttttccgagatggaacaattcactgggggcgcgtgctgacacttctctgctttggttatcgactcg
ctgtggccgtactgagcagagggattcgcggattcttcataaaaatcatcgagtacctcatcaagtacatcaccatcagt
aagattgctcagtggattgctaatcagggcggatgggtcagttcgtttttgattggctgtcgtgttggggtgtgggttac
tagggttgtgttgattgactggctggttcgttga
© 1998-2018