Dataset for CDS Unclassified of Organism Harp seal herpesvirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0R5Z8R0_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Viruses] Harp seal herpesvirus (length=585 residues).
atggattgggaaggcctagtttcatcgttttttgcgggtttctatggacacaacgggctcccctttccaggatttagggg
ggcgcctggcaatcacccgcttggacttcaacttgctaaccttgcccaccaaaacgcccctgcagtagcacacgccctgc
aggcacaaatacaggacattgtgcagcaagacgccgcagatgtcattccattactccaaggtattttccatgatgtgttt
gcagcaaatcggagctggggtagggttgcagctctactggcgtttttgggcgaactcgcagttactgctgccagaagtgg
aaacttaaacctggagacgctggttttggaattcttattatttattctaagaggccagcttggacagtggatagtgactg
agggaggcggcaccgaggggttcttgcaatggatgggcggtagccgcgcgcgtgcaccaggcgctcccacggggccccca
agaagaccaagattcccctggtggagtttgatgttgactatgttcataggtggagccctggccgccatactgttggcttt
gctaacggctagacgccaccggtag
© 1998-2018