Dataset for CDS BAX-like of Organism Gorilla gorilla gorilla

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A2I2Y8H5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=570 residues).
atggcatcggggcaaggcccagggcctcccaggcaggagtgcggaaagcctgccctgcgctctgcttctgaggagcaggt
agcccaggacacggaggggttttccgcagctacagatggcaccctgcgcctccaacctagaagcaccatggggcaggtgg
gacggcagctcgccatcaccaggacgacatcaaccggcactatgacttcggagttccagaccatgctgcagcgtctgcag
cccagggcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccggggccgtgt
ggtggctctcctgggcttcggctaccgtctggtcttacacgtctaccagcacagcctgactggcttcctgggcctggtga
cccgcttcgtggtcttcatgctgcaacacggcattgcccggtggatctcgcagaggggcggctgggtggcagccccggac
ttgggcaatagtcccatcctgaacgtgctggtggttgtgggtggggttctgctgggccagtttgtggtaagaagattctt
caaatcatga
>gnl|bcl2dbcds|A0A2I2ZF28_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcacgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcagggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaagacc
ctggcaacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagctgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
>gnl|bcl2dbcds|G3RSX3_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=462 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccaggccagcagcaacacccacagcctgtttgagagtggcatcaattggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtttaccagcatggcctga
>gnl|bcl2dbcds|G3RSX3_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=579 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccagggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcac
ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaattgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtttaccagcatggcctgactggcttcctaggcc
aggtgacccgcttcgtggttgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|G3RSX3_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=636 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtttaccagcatggcctgactggcttcctaggccaggtgacccgcttcgtggttgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|G3RTU9_BAX-05 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=654 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaagcctcctcacccccaccaccacgccctcaccactgcccctgccccaccgtcccttccccccgccactcctct
gggaccctgggccttctggagcaggtcacagtggtgccctctccccatcttcagatcatcagatgtggtctataatgcgt
ttttacgtgtctga
>gnl|bcl2dbcds|G3RTU9_BAX-03 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=552 residues).
atggacgggtccggggagcagcccagaggcggggtgacacctcgttctgattctgcaccctcactccatccccactctag
gcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtc
tcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccga
gaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactt
tgccagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacgttggact
tcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacg
tggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|G3RTU9_BAX-02 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=600 residues).
atggacgggtccggggagcatttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggaccc
ggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagc
tgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgac
ggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggt
gccggaactgatcagaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccagg
gtggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtctccaggacggcctcctctcctactttgg
gacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggct
gaggcccccagctgccttggactgtgtttttcctccataa
>gnl|bcl2dbcds|G3RTU9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|G3RTU9_BAX-04 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggtg
ccggaactgatcagaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccg
cctcactcaccatctggaagaagatgggctga
© 1998-2018