Dataset for CDS BAX of Organism Gorilla gorilla gorilla

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|G3RTU9_BAX-05 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=654 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaagcctcctcacccccaccaccacgccctcaccactgcccctgccccaccgtcccttccccccgccactcctct
gggaccctgggccttctggagcaggtcacagtggtgccctctccccatcttcagatcatcagatgtggtctataatgcgt
ttttacgtgtctga
>gnl|bcl2dbcds|G3RTU9_BAX-03 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=552 residues).
atggacgggtccggggagcagcccagaggcggggtgacacctcgttctgattctgcaccctcactccatccccactctag
gcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtc
tcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccga
gaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactt
tgccagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacgttggact
tcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacg
tggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|G3RTU9_BAX-02 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=600 residues).
atggacgggtccggggagcatttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggaccc
ggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagc
tgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgac
ggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggt
gccggaactgatcagaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccagg
gtggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtctccaggacggcctcctctcctactttgg
gacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggct
gaggcccccagctgccttggactgtgtttttcctccataa
>gnl|bcl2dbcds|G3RTU9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|G3RTU9_BAX-04 BCL2-associated X gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtactcaaggccctgtgcaccaaggtg
ccggaactgatcagaaccatcatgggctggacgttggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccg
cctcactcaccatctggaagaagatgggctga
© 1998-2018