Dataset for CDS BAK1 of Organism Gorilla gorilla gorilla

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2I2Y8H5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=570 residues).
atggcatcggggcaaggcccagggcctcccaggcaggagtgcggaaagcctgccctgcgctctgcttctgaggagcaggt
agcccaggacacggaggggttttccgcagctacagatggcaccctgcgcctccaacctagaagcaccatggggcaggtgg
gacggcagctcgccatcaccaggacgacatcaaccggcactatgacttcggagttccagaccatgctgcagcgtctgcag
cccagggcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccggggccgtgt
ggtggctctcctgggcttcggctaccgtctggtcttacacgtctaccagcacagcctgactggcttcctgggcctggtga
cccgcttcgtggtcttcatgctgcaacacggcattgcccggtggatctcgcagaggggcggctgggtggcagccccggac
ttgggcaatagtcccatcctgaacgtgctggtggttgtgggtggggttctgctgggccagtttgtggtaagaagattctt
caaatcatga
>gnl|bcl2dbcds|G3RSX3_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=636 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtttaccagcatggcctgactggcttcctaggccaggtgacccgcttcgtggttgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|G3RSX3_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=579 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccagggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcac
ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaattgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtttaccagcatggcctgactggcttcctaggcc
aggtgacccgcttcgtggttgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|G3RSX3_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAK1 (length=462 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccaggccagcagcaacacccacagcctgtttgagagtggcatcaattggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtttaccagcatggcctga
© 1998-2018