Dataset for CDS Unclassified of Organism Geodia cydonium

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q9N9X1_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Geodia cydonium (length=768 residues).
atggccactgggtcactgacttgttactccttcacccactcgccccgctctgtgccgaaacgccatcagctacatcagcg
agcgtcgcctaaacaacagcgagcagtccgcggaggaggagagaagagaatgagcgacgacccagccgtagtccaggcgg
agttcctcgctaaggacgtagtggagtatctactaaacaaggaggggatgtcggtgaatgggtacacggacgttctcccc
gggcaccttagaaaagtaccacggaaagagagacaatgtctacacgagccatcttttgaacaagctcggaggcaaatcgt
ctgcgggtgtcaatgcattatgcatcagcacggcgtggaaatagagcagatctgcatgaaagtggacgtgggagacgagc
acctttactcgaatgtgaaagaagcgctagcgacaatctgggaagaaccgaaaaactggggacggttagtgtccctcttc
gtggcggcttactacctgtgcaagagaatttgcgacgaggaaggagaggggagcgagaagattgacagcgtcatcggatg
gctggccagttttctgaaggaaaacgcagtcccgtgggtcgtggaacgtggcggctttgctggtgtgctctatggcacta
acataaagccacaggcggcaggagctgcagtcgaagattgtaaatctgactacacaaaagccagtctatttgtgacggct
ctcgggctcggcgcagcggtggttgttgggaccatcatagggagataa
© 1998-2018