Dataset for CDS BOK of Organism Gasterosteus aculeatus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|G3NL80_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=633 residues).
atggacatgttgcgccgctcgtctgtgttcgcggccgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaggcgctgtgccgggactacattcactccaggctcaaccgcgccgggatgggctggtcgaagcccgagtccgggc
gcgccgcaccgggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggagtaccttcgaccc
aacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggagagcattgtgtccgatgccttcctggctgt
ggctgcagacattttctccacaggtgtgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtgg
actgcgttcgccacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgacc
acctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtgaacacagaccccagcttccgctctcactg
gctggtgtcggccgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|G3NL80_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=633 residues).
atggacatgttgcgccgctcgtctgtgttcgcggccgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaggcgctgtgccgggactacattcactccaggctcaaccgcgccgggatgggctggtcgaagcccgagtccgggc
gcgccgcaccgggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggagtaccttcgaccc
aacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggagagcattgtgtccgatgccttcctggctgt
ggctgcagacattttctccacaggtgtgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtgg
actgcgttcgccacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgacc
acctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtgaacacagaccccagcttccgctctcactg
gctggtgtcggccgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|G3NL80_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=432 residues).
atgtcttggccaggtgatgagttggagtaccttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggt
ggcgtcggagagcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtgtgacatgggggaagg
tggtgtctctgtacgccgtggcgggagccctggctgtggactgcgttcgccacggccacccagctattgtccataccatt
gtcgactgcatgggggagtttgtccgcaagagcctgaccacctggctgaaaaggagagggggctgggtggatgttacgaa
atgcgtggtgaacacagaccccagcttccgctctcactggctggtgtcggccgtctgtgccttcggacactatctgaagg
ccactgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|G3PKC3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=642 residues).
atggaggtcctgcggcggccgtccgtgatggctgctgaggtcctggatgtgtttgaccgatcgctgacggagaaggagct
ggtgtcccagtctaaagccctgtgcagggactacatactgtctagactccaccagaatggacagggatggtccaagactg
aactccacctctctccctcaagtgcagcgctcgccgaggtgtctttggtgctcctctgccttggcgacgagctggagtcc
atacggcccagtttgtacaggaacgtggcgcggcagctcaacatctctgttgccatggagaacatggtttcagatgcctt
catcggcgtggcaacggagatcttctcaacagggatcacatggggaaaggtggtgtccatgtatgcagtagccggagccc
tggcggtggactgtgtccgtcagggccacccagccaccgttcacatcttggtggccagtctgggacagtttgtccgcaag
tttctggtcccctggctgaagagacggggaggatgggcggagatgtgtaaatgtgtgttgaagaaggatcttcccccgga
gcaccactggctgtcgtctgcaatggattccctgaaatacttcctcaccgcgctgtacgtctgcgtcatgaaggagccgt
ga
© 1998-2018