Dataset for CDS BAX-like of Organism Gasterosteus aculeatus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|G3NL80_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=633 residues).
atggacatgttgcgccgctcgtctgtgttcgcggccgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaggcgctgtgccgggactacattcactccaggctcaaccgcgccgggatgggctggtcgaagcccgagtccgggc
gcgccgcaccgggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggagtaccttcgaccc
aacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggagagcattgtgtccgatgccttcctggctgt
ggctgcagacattttctccacaggtgtgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtgg
actgcgttcgccacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgacc
acctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtgaacacagaccccagcttccgctctcactg
gctggtgtcggccgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|G3NL80_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=633 residues).
atggacatgttgcgccgctcgtctgtgttcgcggccgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaggcgctgtgccgggactacattcactccaggctcaaccgcgccgggatgggctggtcgaagcccgagtccgggc
gcgccgcaccgggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggagtaccttcgaccc
aacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggagagcattgtgtccgatgccttcctggctgt
ggctgcagacattttctccacaggtgtgacatgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtgg
actgcgttcgccacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgacc
acctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtgaacacagaccccagcttccgctctcactg
gctggtgtcggccgtctgtgccttcggacactatctgaaggccactgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|G3NL80_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=432 residues).
atgtcttggccaggtgatgagttggagtaccttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggt
ggcgtcggagagcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtgtgacatgggggaagg
tggtgtctctgtacgccgtggcgggagccctggctgtggactgcgttcgccacggccacccagctattgtccataccatt
gtcgactgcatgggggagtttgtccgcaagagcctgaccacctggctgaaaaggagagggggctgggtggatgttacgaa
atgcgtggtgaacacagaccccagcttccgctctcactggctggtgtcggccgtctgtgccttcggacactatctgaagg
ccactgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|G3PKC3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gasterosteus aculeatus GN=BOK (length=642 residues).
atggaggtcctgcggcggccgtccgtgatggctgctgaggtcctggatgtgtttgaccgatcgctgacggagaaggagct
ggtgtcccagtctaaagccctgtgcagggactacatactgtctagactccaccagaatggacagggatggtccaagactg
aactccacctctctccctcaagtgcagcgctcgccgaggtgtctttggtgctcctctgccttggcgacgagctggagtcc
atacggcccagtttgtacaggaacgtggcgcggcagctcaacatctctgttgccatggagaacatggtttcagatgcctt
catcggcgtggcaacggagatcttctcaacagggatcacatggggaaaggtggtgtccatgtatgcagtagccggagccc
tggcggtggactgtgtccgtcagggccacccagccaccgttcacatcttggtggccagtctgggacagtttgtccgcaag
tttctggtcccctggctgaagagacggggaggatgggcggagatgtgtaaatgtgtgttgaagaaggatcttcccccgga
gcaccactggctgtcgtctgcaatggattccctgaaatacttcctcaccgcgctgtacgtctgcgtcatgaaggagccgt
ga
>gnl|bcl2dbcds|G3PM69_BAX-02 BCL2-associated X gene OS=[Eukaryota] Gasterosteus aculeatus GN=BAX (length=546 residues).
aacaaagaccagatcctggaactaggaactgttttgctgaaggatttcatcttcgagcgggttaagcggcatggagacag
caccgagactgtgaccaggacgcagctgggtggagtggagctgagcgacccgaaccacaagaagctggccatgtgcctgc
agcagatcggagacgagttggacggaaacgtagagcttcaaagaatgatgaacgactcttcgctcggtcccacaaaagat
gtgtttttgaaagttgccttcgagatcttttcggatggaaaattcaactggggccgggtggtcgcactgttctactttgc
ctgtcgactcgtcatcaaagctcttgtgaccaaagttcctgacataatccgaacgataatcagctggaccatggactacc
tccgcgaacatgtgatcaactggatcagggagcaaggtggctgggagggcattcgctcccacctcggcacacccacatgg
cagacggtgggagttttcttggccggggtcctcactaccgttttagtcattcgcaagatggttgga
>gnl|bcl2dbcds|G3PM69_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gasterosteus aculeatus GN=BAX (length=579 residues).
atggcatcgcaccccggaggaggcgatcaaggcaataacaaagaccagatcctggaactaggaactgttttgctgaagga
tttcatcttcgagcgggttaagcggcatggagacagcaccgagactgtgaccaggacgcagctgggtggagtggagctga
gcgacccgaaccacaagaagctggccatgtgcctgcagcagatcggagacgagttggacggaaacgtagagcttcaaaga
atgatgaacgactcttcgctcggtcccacaaaagatgtgtttttgaaagttgccttcgagatcttttcggatggaaaatt
caactggggccgggtggtcgcactgttctactttgcctgtcgactcgtcatcaaagctcttgtgaccaaagttcctgaca
taatccgaacgataatcagctggaccatggactacctccgcgaacatgtgatcaactggatcagggagcaaggtggctgg
gagggcattcgctcccacctcggcacacccacatggcagacggtgggagttttcttggccggggtcctcactaccgtttt
agtcattcgcaagatgtga
>gnl|bcl2dbcds|G3PMZ5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gasterosteus aculeatus GN=BAX (length=615 residues).
atggccgacggcgggagagaaaagcaagacgacggagaccgggaacctcggggcgccgagggcggggaagatgtggtcga
tgatcccatcatggagcaaggagcagtggttctcagagggtacgtggtgtcacgtataaacgcagaagaccccagtcggc
acgtgtcgcctgaacaactgggaggacgcccgaatgaacatcaggatccgcaaatcaaagaagtggtgaagcagctaatg
aagattgcagatgagatgaacaggaacgccgagctccaacgactgatcagccaggttccgggcaactgtgctcaggacat
cttcatgaaggtcgccaaaagcatcttcgacgatggcatcaactggggtcgagtggtggctctgttccatctggcctacc
ggctcatatacagggcactgaccaccaaccacctcgagaacatcaggataataatcggctgggttctgcggttcatcagg
gagcgactctacccctggctcgtgcagcagggcggctgggtgggcgtgatcaacgggttttctcgatggaggaatgtggc
catcgtagcatcggtagcattggtggtagctcttgtttactaccggaagacgcgc
© 1998-2018