Dataset for CDS Unclassified of Organism Gallus gallus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|C5J074_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Gallus gallus (length=624 residues).
atggcttgtgaagcctcacaggattatcagattggagaggccctcttaataggggtagtaaggcaggagctaatggaggt
gatggaggtgactgaaggaaatgcagctcctccagctcttcctgaagctaaaccaataagcaacagccaggaccagattc
tggttcagcagctggcgaacaccatcaaagtgatcggtgacaaactcgaccaggatcaagcatttaacgacatgatcgat
ggcttagtaaaggtagctgataaaagcagtttctggaaacttgtggaaaaggtgttcacagatggccagatcaactgggg
cagaattatcgtgctgttttattctgttggaaaactgtcagccaagatggtcgtcgctcgcctacccagaattgtttcag
atattttatcattaagtcttgattacttcaaaagaaatctgttgcagtggattctcacagtaggaggatggatgaacagt
atccctgcactggcctgtttctctgttgaccaattttctggttcttcaatgagaaaatattctccttacgttggagttgt
gtttgccttcactggtggcctactgctgggtggcttcatcgtctcgagatttcagaaaacctga
>gnl|bcl2dbcds|E1C005_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gallus gallus (length=447 residues).
atgtcccaggcacggcggagccccaggcgcgtccttctctccagataccccaacggagcgccagaggagcagacgtacgg
cagcctcctggcagcgccagacgctgcagagcaaatggaactcaatatcagctcagctatccaggttggccatcagctgg
cactgattggggatgaatttaacagagcctacagcaggaagattgaagacacactgcttcacctggcacgcagggttgct
atcagtgttttccagacgtggaatattattaaaagcgttacaagaagctttggaaactttttgaacaataactggacaaa
gaggatcgctggctatggaagctgggtttgccggcttcctttcaggtgtgtctgccagaagctggtgcctgcagctctgc
tcgctgtcgcattttggtgggccataagctatggactgcagaattaa
>gnl|bcl2dbcds|E9JEC5_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gallus gallus (length=447 residues).
atgtcccaggcacggcggagccccaggcgcgtccttctctccagataccccaacggagcgccagaggagcagacgtacgg
cagcctcctggcagcgccagacgctgcagagcaaatggaactcaatatcagctcagctatccaggttggccatcagctgg
cactgattggggatgaatttaacagagcctacagcaggaagattgaagacacactgcttcacctggcacgcagggttgct
atcagtgttttccagacgtggaatattattaaaagtgttacaagaagctttggaaactttttgaacaataactggacaaa
gaggatcgctggctatggaagctgggtttgccggcttcctttcaggtgtgtctgccagaagctggtgcctgcagctctgc
ttgctgtcgcattttggtgggccataagccatggactgcagaattaa
© 1998-2018