Dataset for CDS BOK of Organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|F1N8M0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gallus gallus GN=BOK (length=642 residues).
atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctg
agcacaataccccggtgcctggaggcaagctggctgaggtgtctgccatcctgctgtgcctgggggatgagctggaatac
attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggatgcttt
cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctctctatgccgtggcagcggggc
tggcagtggactgcgtgcggcacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtgagcaccgaccccagtctccg
ttcccactggctcgtggccgccgtctgcagctttgggcacttcctcaaggccatcttctttgtgctgctgcccgagagat
ga
>gnl|bcl2dbcds|F1N8M0_BOK-04 BCL2-related ovarian killer gene OS=[Eukaryota] Gallus gallus GN=BOK (length=642 residues).
atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctg
agcacaataccccggtgcctggaggcaagctggctgaggtgtctgccatcctgctgtgcctgggggatgagctggaatac
attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggatgcttt
cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctctctatgccgtggcagcggggc
tggcagtggactgcgtgcggcacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtgagcaccgaccccagtctccg
ttcccactggctcgtggccgccgtctgcagctttgggcacttcctcaaggccatcttctttgtgctgctgcccgagagat
ga
>gnl|bcl2dbcds|F1N8M0_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Gallus gallus GN=BOK (length=642 residues).
atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctg
agcacaataccccggtgcctggaggcaagctggctgaggtgtctgccatcctgctgtgcctgggggatgagctggaatac
attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggatgcttt
cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctctctatgccgtggcagcggggc
tggcagtggactgcgtgcggcacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtgagcaccgaccccagtctccg
ttcccactggctcgtggccgccgtctgcagctttgggcacttcctcaaggccatcttctttgtgctgctgcccgagagat
ga
>gnl|bcl2dbcds|F1N8M0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gallus gallus GN=BOK (length=642 residues).
atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctg
agcacaataccccggtgcctggaggcaagctggctgaggtgtctgccatcctgctgtgcctgggggatgagctggaatac
attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggatgcttt
cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctctctatgccgtggcagcggggc
tggcagtggactgcgtgcggcacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtgagcaccgaccccagtctccg
ttcccactggctcgtggccgccgtctgcagctttgggcacttcctcaaggccatcttctttgtgctgctgcccgagagat
ga
>gnl|bcl2dbcds|Q9I8I2_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gallus gallus GN=BOK (length=642 residues).
atggaagtgctgcgccgctcgtccgtctttgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagggactacatcaactccaggctgatccgtgcaggcgtcagctggagcaaacctg
agcacaataccccggtgcctggaggcaagctggctgaggtgtctgccatcctgctgcgcctgggggatgagctggaatac
attcgccccaacgtctaccgcaacatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggatgcttt
cctggccgtggctgcgcagatcttcactgcaggcataacatggggcaaggtggtgtctctctatgccgtggcagcggggc
tggcagtggactgcgtgcggcacgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtgagcaccgaccccagtctccg
ttcccactggctcgtggccgccgtctgcagctttgggcacttcctcaaggccatcttctttgtgctgctgcccgagagat
ga
© 1998-2019