Dataset for CDS BAK1 of Organism Gallus gallus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q5F404_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Gallus gallus GN=BAK1 (length=651 residues).
atggaagggaacgagggggacccacccggggcccacagacgccgggacagccatgggcgcaggccatcacgagagatcaa
tgcagaggaccaggtggcccaggagaccgaggaggtgttccggagctacaccttctaccgctaccaacaggagagagagg
agggaggggcggaggtgcccatggacccggagatcatggagatccagcaggagctgggcagcaccgggagccaggtgggc
aggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcggagttccgccatatgctgaagtccttgcagcc
caccaaggagaacgcctacgagtacttcaccaccatcgcctccagcttgttcgacagcggcattaactggggccgggtga
ttgccctgctgggtttcggttactgcatggccatccacgtctaccagcaaggcatcacgggcttcctgcgccgcatcgcc
cgctacgtcaccgaattcatgctgcgcaaccgcatcgcacggtggatcgcccagcagggaggatgggtggctgcactcga
tctggacaatgtttacatgaagtacatgctggtggtgctggccctggtgatggtggggcatttagtggtacgacgcttct
tcaggccctga
© 1998-2018