Dataset for CDS BAX-like of Organism Fukomys damarensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A091CXZ1_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Fukomys damarensis GN=BAK1 (length=639 residues).
atggcatccaaccaaggccccggtccccctggtgagggctgcgaggaggcccccgggccatcgttagctgagcagcaggt
ggcccgggacaccgaggaggttttccaaagctacgtgtactaccgccaccggcaggagcaggaggccgagggcgcggccg
cccctgctgaccctgagatggagaccctgtccctagagccaagcagcaccctgggccaggtgggtcggcgactggccatc
atcggggatgacatcaaccggcgctacgacgctgagttccagaacctgctgcggcagctgcagcccacagccgaaaacgc
ctacgacctcttcatcaggatcgcatccaggctgtttaagagcggcatcacctggggccgtgtggtggcgctcctgggtt
ttggctatcgcctggccctgcacgtctaccagcacggcctgtctggcttcctgggcaaggtgaccaggctggtggtggac
tgcatgctgcactactgcattgctgggtggatcgcacagagaggcggctgggtggcagccctggacttgggcaacggccc
catccggaacgtgctgctagtcctggctgtggttctgttggggcagtacgtggtacgaaggttcttcaaatcatcgtga
© 1998-2018