Dataset for CDS BOK of Organism Ficedula albicollis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3JLA0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ficedula albicollis GN=BOK (length=645 residues).
atggaggtgctgcgccgctcctcagtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaagagct
tgtgtcccaagccaaggctctctgcagagactacataaactcaaggctgattcaggcaggtgtcagctggagcaaacccg
agcacaacgccccagtgcctgggggcaagctggccgaggtgtccaccatactgctgagacttggggatgagctggagtac
attcgccccaacgtctacaggaacatcgcccgccagctgaacatctctctgcactctgagaccgtggtgtctgacgcctt
cctggcagtggctgcacagattttcactgcagcaggcataacgtggggcaaggtggtgtctctgtacgccgtggcagccg
ggctggccgtggactgcgtgcggcacgcgcagccagccatggttcacaccatcgtggactgcctgggagagtttgtgagg
aagaccttggtgacgtggctgaaaaggagaggaggctgggcagacatcaccaagtgcgtggtgaatactgaccccagcct
tcgctcccactggctcgtggctgctgtttgcagttttggtcacttcctcaaggccatcttctttgtcctgctgcctgaga
gatga
© 1998-2018