Dataset for CDS BAX of Organism Ficedula albicollis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3K1D1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ficedula albicollis GN=BAX (length=228 residues).
gagccccagcccagcagcccggacaccaagcgcctcagcgagtgcctgcggcgcatcggcgacgagctcgacagcaacat
ggggggccccaggatgatcgagcaggtgggctgtgacgcccccaaaaagctgtttttccgcgtggccaaggagatgttcg
ccgacggcaccttcaactggggccgcgtagtcgccctgttctactttgcctgcaagctggtgctgaag
© 1998-2018