Dataset for CDS BAK1 of Organism Ficedula albicollis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3JMQ7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ficedula albicollis GN=BAK1 (length=642 residues).
atggcctcggggaatgagggggaccctccacagctggaggaacgccgggggagccacaggcgccggctcagctcagaggg
ccgggtggcggaggaggctgaggaggtgttcaggagctacgccttccaccgctaccagcaggagcgccaggagcgagggg
cagagctgccgcccgaccccgagatcgagcaaatccagcaggacctggacagcaccggcagccaggtggggcagcgcttg
gccatcatcggcgatgacatctaccggcgctacgacgccgagttccgcaccatgctggagagcctgcagcccacccgcga
caacgcctacgagaacttcaccaaaatcgcctccagcctgtttgagagcggcatcaactggggccgggtgatcgccctgc
tggcctttggctaccgcctggccatgcacgtgtggcagcgcggggtcagcggcttcctgcggcgcatcgcgcagcacctg
gcgcagttcatgctgcagaaccgcatcgcccgctggatcgcccagcagggaggatggagggccgcgctgcgccgctacaa
cgaagtttacatcaagtacctgctggtggccgccgcggtgctgctggcacacctggcggtgcggcgcttcctcacctcct
ga
© 1998-2018