Dataset for CDS BAX of Organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|M3VUD8_BAX-03 BCL2-associated X gene OS=[Eukaryota] Felis catus GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgatcgcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatg
gcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgagctgatccggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctgactg
cgtcactcaccatctggaaaaagatgggctga
>gnl|bcl2dbcds|M3VUD8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Felis catus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacgcccgagctggccctggagcaggtgccccaggacg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatc
gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatggcaacttcaactg
gggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctgactgcgtcactcaccat
ctggaaaaagatgggctga
>gnl|bcl2dbcds|M3VUD8_BAX-02 BCL2-associated X gene OS=[Eukaryota] Felis catus GN=BAX (length=516 residues).
atggacgggtccggggagcagcccagaggcgggggtgagtttcatccaagatcgagcaggacgcccgagctggccctgga
gcaggtgccccaggacgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgaactggacagtaacatgg
aattgcagaggatgatcgcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttcc
gatggcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaa
ggtgcccgagctgatccggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggacc
agggtggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctg
actgcgtcactcaccatctggaaaaagatgggctga
>gnl|bcl2dbcds|Q8SQ43_BAX-01 BCL2-associated X gene OS=[Eukaryota] Felis catus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcacaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacgcccgagctggccctggagcaggtgccccaggacg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatc
gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatggcaacttcaactg
gggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggcgggagtgctgactgcgtcactcgccat
ctggaaaaagatgggctga
© 1998-2018