Dataset for CDS Unclassified of Organism Exaiptasia pallida

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q3HLW5_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Exaiptasia pallida (length=465 residues).
atgccaccgataatacctgactacgacgacgcatctatggatgtaagaaaaatgaaatctcccgacgaaaaactggcttt
ggatttagccaaagacttgatacagtggaagattggcaaacgaaatttgttgaacagtaaaaccgcttgtttacttcgaa
agctgagcacacaaatcgagcaaaagcacgaagctttgttcaagaatttgtgcaatcgacttgacttgaatgaacgtaat
gtaacagaaacatgcggacaaatcgccgatgagcttatcggaaatgatatcaactggggccgtatcgttgtgttgtacac
tttcggagcaaaggtagccgaacattttcacgaaaatggaactgatttgagtgacgagatttcaaaatggattggaaatt
acatggcgaaaaagtccgactggattcgaaaagcaggcggatgggtaagtttgaatgaacactga
© 1998-2018