Dataset for CDS BAX-like of Organism Esox lucius

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C1BWE2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Esox lucius GN=BAX (length=534 residues).
atggagcgaacagcgattgttttcagagggtttgtcatccgaaggattagtacagatgatccacagagacatttgtctcc
agaagaccttggcggtgaatccaatgaactggaggaccgtcaaattaaagatgtagtcagccagctgctgataatcgctg
acgacctgaatcgaaacgctgagctacaacacctaatgagcacagttcaggccaactgtgcacaggatgtcttcttctcg
gtggccagggaaatccttgtagatggcatcaactggggacgtgtggttgcactttttcacctggcttacaagcttatcta
cttggcattgacacagaaccacttagaaatcattaagaagattataagctggtttattacagttcatcagggaacacgtc
tccgcttggatcagacagcaaggaggatgggaggcggtcatcagaagcgtgtcacactggcgtactgtgtcgctcgcggc
ggcaatagctttcattgccgtagtggtttactggaggaaaacccactgacctga
© 1998-2018