Dataset for CDS BAX-like of Organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|F6XWS9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Equus caballus GN=BAK1 (length=636 residues).
atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcctccacttctgaggagcaggt
agcccgggacacggaggaggttttccgcagctacgtttattaccgccaccagcaggagcaggaggccgagggggcggctg
cgcccgccgacccagagatggacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctgcagccaacagcagagaacgc
ctatgagctgttcaccaagatcgcctcgagcctgtttgagagcggcatcaactggggccgagtggtggctctcctggggt
tcggctaccgcctggccctgcatgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggctgaa
ttcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggcggctctggacttgggaaatggccc
catccggaatgtgctgatagttctggctgtggttctgttgggccagtatgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|F6YGW2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Equus caballus GN=BAX (length=522 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgcgcggggcggatggggggagacacacccgagctggg
cctggaggaggtgccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgagctggacagta
acatggagctgcagaggatgattgcggccgtggacacggactccccccgcgaggtctttttccgagtggcagctgagatg
ttttccgacggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaattggtgctcaaggccctgag
cacaaaattaattgtagagtctagattgctggtatggggcacctgtaagagtcctggcgaacgatggctgacctggactc
aggtggtagctgtggaggacggcctcctctccgactttgggtcacccacgtggcagacagtgaccatcttcgtggccgga
gtgctcaccgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|F7CDD0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Equus caballus GN=BOK (length=414 residues).
gatgagctggagctgatccggcccagtgtctaccgcaacgtggctcgccagctgaacatctcactgcagtctgagaccgt
ggtgactgacgccttcctggctgtgtctgcccagatcttcgcaggcatcacgtggggcaaggtggtgtccctgtacttgg
tggctgcggggctggccgtggactgcgtgcggcaggcccagcccgccatggtccatgctctcgttgactgcctcggggag
tttgtgcgcaagaccctggcgacctggctgcggaggcgtggcggatggactgacgtcctcaagtgtgtggtcagcacgga
ccccggctaccgctcccattggctcgtggctgcgttctgcagtgtcggccgcttcctgaaggctgccttcttcatgctgt
tgccagagagatga
© 1998-2018