Dataset for CDS BAK1 of Organism Equus caballus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6XWS9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Equus caballus GN=BAK1 (length=636 residues).
atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcctccacttctgaggagcaggt
agcccgggacacggaggaggttttccgcagctacgtttattaccgccaccagcaggagcaggaggccgagggggcggctg
cgcccgccgacccagagatggacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctgcagccaacagcagagaacgc
ctatgagctgttcaccaagatcgcctcgagcctgtttgagagcggcatcaactggggccgagtggtggctctcctggggt
tcggctaccgcctggccctgcatgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggctgaa
ttcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggcggctctggacttgggaaatggccc
catccggaatgtgctgatagttctggctgtggttctgttgggccagtatgtggtacgaagattcttcaagtcatga
© 1998-2018