Dataset for CDS BAX of Organism Epinephelus coioides

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A219P128_BAX-01 BCL2-associated X gene OS=[Eukaryota] Epinephelus coioides GN=BAX (length=579 residues).
atggcatcgcacccgggaggaggtgatcaaggcaaaagtaaagatgacataatggaagtaggagctgatttgttgaaaga
tttcatataccagcgggttaaaaggcatggagacggcagtactgcagtgaccagagaacagctgggtggaggagagctgt
gcgacccaaataccaagaggcttgcccgatgcctgcagcagattggagatgagctggatggaaatgttgagctccaaagg
atgataaatgactcttcactcagtcccacaaaagacatgttcattaaagttgccattgagatcttttcagatggaagatt
caactggggcagggtggttgcactgttctactttgcttgtcgacttgtcatcaaagctcttgtgactcatgttcctgata
tcatcagaactataatcagctggaccatggactacctccgggaaaacgtaatcaactggatcagggagcaaggtggctgg
gagggtattcgggcccactttggcacacccacatggcagacggtgggagtgttcacggctggtgttctcaccactttact
agttatttacaagatgtga
© 1998-2018