Dataset for CDS Unclassified of Organism Danio rerio

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|E7F560_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Danio rerio (length=501 residues).
atgagtgtgccctctcttcctgagacgcagccaatgaatgatgatcaggagcaacttctggagcagattactaacgtcat
tctactaatcggtgatgttgtagatcgagaccaaacaatcataaacttgactgataggtttgcatgcgtgctggaaagac
agcatttccagagacttgcagacaaagtgtttcaggatggtatcacctggggaaaaattgcttccctgatctgtattgtt
ggaaaaacaattgtgaagattattggcaattacattcctgactttgtgtcttggacactgcattacttcaaggataacct
acagacctggatctgcaatatgggaggatggatcaatagtatctcctccttggcccgtttctcccttgagttggatttgg
gctcctcctccagtatgatctggtcctcctctggactcctcttcatcagtggaatgctgttaggaggcttcatcgtctgg
agcctgattagacgagcctga
>gnl|bcl2dbcds|F1QTZ0_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Danio rerio (length=624 residues).
atggcttgtgaagcctcacaggatgatcagattggagaggcactcttaataggggtagtaaggcaggagctaatggaggt
gatggaggtgactgaaggaaatgcagctcctccagctcttcctgaagctaaaccaataagcaacagccaggaccagattc
tggttcagcagctggcgaacacaatcaaagtgatcggtgacaaactcgaccaggatcaagcatttaacgacatgatcgat
ggcttagtaaaggtagctgataaaagcagtttctggaaacttgtggaaaaggtgttcacagatggccagatcaactgggg
cagaattatcgtgctgttttattctgttggaaaactgtcagccaagatggtcgtcgctcacctacccagaattgtttcag
atattttatcattaagtcttgattacttcaaaaggaatctgttgcagtggattcgcacagtaggaggatggatgaacagt
atccctgcactggcctgtttctctgttgaccaattttctggttcttcactgagaaaatattctccttacgttggagttgt
gtttgccttcactggtggcctactgctgggtggcttcatcgtctcgagatttcagaaaacctga
>gnl|bcl2dbcds|Q5EAR7_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Danio rerio (length=624 residues).
atggcttgtgaagcctcacaggattatcagattggagaggccctcttaataggggtagtaaggcaggagctaatggaggt
gatggaggtgactgaaggaaatgcagctcctccagctcttcctgaagctaaaccaataagcaacagccaggaccagattc
tggttcagcagctggcgaacaccatcaaagtgatcggtgacaaactcgaccaggatcaagcatttaacgacatgatcgat
ggcttagtaaaggtagctgataaaagcagtttctggaaacttgtggaaaaggtgttcacagatggccagatcaactgggg
cagaattatcgtgctgttttattctgttggaaaactgtcagccaagatggtcgtcgctcgcctacccagaattgtttcag
atattttatcattaagtcttgattacttcaaaagaaatctgttgcagtggattctcacagtaggaggatggatgaacagt
atccctgcactggcctgtttctctgttgaccaattttctggttcttcaatgagaaaatattctccttacgttggagttgt
gtttgccttcactggtggcctactgctgggtggcttcatcgtctcgagatttcagaaaacctga
© 1998-2018