Dataset for CDS BOK of Organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A0R4IZP5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=675 residues).
atgaagggcatggagatgttgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttgatcgctctcccacgga
caaggagctcgtgtctcagtccaaagtgttgtgtagggattatattcactccagactgcaccgggctggaatcgggtggt
cgaaaccagaacacgggtctggaggaaccctggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
ctgcgtcccaacgtctaccgcaacgtagctcgacagctcaacatcacaatagcctctgagaatatcgtctctgatgcctt
tctggccgtcgctgctgaaatcttctccacagaatatagtcgaaaaggtttggaaaaacataagggtgtaacatggggga
agattgtgtctctgtatgcagtggctggagctctagctgtggactgtgttcggcatggacatccagcaatggtgcacact
atcgtcgactgcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagagaggaggctgggcggacataac
aaagtgtgtcgtcagtacagaccccagtttccactctcactggctagtaacggccgcctgcgcctgcggtcactacctta
aggctgtggttttctacctgctgagagagaaatga
>gnl|bcl2dbcds|A0A0R4IZP5_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=663 residues).
atgaagggcatggagatgttgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttgatcgctctcccacgga
caaggagctcgtgtctcagtccaaagtgttgtgtagggattatattcactccagactgcaccgggctggaatcgggtggt
cgaaaccagaacacgggtctggaggaaccctggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
ctgcgtcccaacgtctaccgcaacgtagctcgacagctcaacatcacaatagcctctgagaatatcgtctctgatgcctt
tctggccgtcgctgctgaaatcttctccacaggctctgtctgtttctttacaggtgtaacatgggggaagattgtgtctc
tgtatgcagtggctggagctctagctgtggactgtgttcggcatggacatccagcaatggtgcacactatcgtcgactgc
atgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagagaggaggctgggcggacataacaaagtgtgtcgt
cagtacagaccccagtttccactctcactggctagtaacggccgcctgcgcctgcggtcactaccttaaggctgtggttt
tctacctgctgagagagaaatga
>gnl|bcl2dbcds|B0S7M3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=645 residues).
atgcgggacatgaacgtgttcgcgcgctcctccgtgctcgccgccgagatgatggatgtgtttgatcgcactcacacgga
gaaagagctcgtctttcagtccaaggagctgtgtagagacttcattcactccaggatcacgagagaaggactgagttggt
caaaagtcgagctggacctgccagaaccgcgcggagttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaa
ctggagtgcatgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgtatcggtggaagctgtggtttc
agatgcatttctctcggtagcaacagaagtcatagccatgggaatcacatggggtaaagtggtggccatctacgctgtag
ctgccgggcttgcggtggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggacagtctgggagagttt
gtgcggagaagtctcgtgccatggctcaaaaagagaggaggatgggttgacattttaaaatgtgtggtgaacatggactc
tagagctcatgtccattggttatcgacagcagtgttaacatggagggaattcataaagactatgtacgtctacctgacga
agtag
>gnl|bcl2dbcds|B2GRX5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=636 residues).
atgaacgtgttcgcgcgctcctccgtgctcgccgccgagatgattgatgtgtttgatcgcactcacacggagaaagagct
cgtctttcagtccaaggagctgtgtagagacttcattcactccaggatcacgagagaaggactgagttggtcaaaagtcg
agctggacctgccagaaccgcgcggagttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgtatcggtggaagctgtggtttcagatgcatt
tctctcggtagcaacagaagtcatagccatgggaatcacatggggtaaagtggtggccatctacgctgtagctgccgggc
ttgcggtggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggacagtctgggagagtttgtgcggaga
agtctcgtgccatggctcaaaaagagaggaggatgggttgacattttaaaatgtgtggtaaacatggactctagagctca
tgtccattggttatcgacagcagtgttaacatggagggaattcataaagactatgtacgtctacctgacgaagtag
>gnl|bcl2dbcds|Q6DC66_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=666 residues).
atggagatgttgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttgatcgctctcccacggacaaggagct
cgtgtctcagtccaaagtgttgtgtagggattatattcactccagactgcaccgggctggaatcgggtggtcgaaaccag
aacacgggtctggaggaaccctggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtacctgcgtccc
aacgtgtaccgcaacgtagctcgacagctcaacatcacaatagcctctgagaatatcgtctctgatgcctttctggccgt
cgctgctgaaatcttctccacagaatatagtcgaaaaggtttggaaaaacataagggtgtaacatgggggaagattgtgt
ctctgtatgcagtggctggagctctagctgtggactgtgttcggaatggacatccagcaatggtgcacactatcgtcgac
tgcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagagaggaggctgggcggacataacaaagtgtgt
cgtcagtacagaccccagtttccactctcactggctagtaacggccgcctgcgcctgcggtcactaccttaaggctgtgg
ttttctacctgctgagagagaaatga
>gnl|bcl2dbcds|Q7T381_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=636 residues).
atgaacgtgttcgcgcgctcctccgtgctcgccgccgagatgattgatgtgtttgatcgcactcacacggagaaagagct
cgtctttcagtccaaggagctgtgtagagacttcattcactccaggatcacgagagaaggactgagttggtcaaaagtcg
agctggacctgccagaaccgcgcggagttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgtatcggtggaagctgtggtttcagatgcatt
tctctcggtagcaacagaagtcatagccatgggaatcacatggggtaaagtggtggccatctacgctgtagctgccgggc
ttgcggtggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggacagtctgggagagtttgtgcggaga
agtctcgtgccatggctcaaaaagagaggaggatgggttgacattttaaaatgtgtggtaaacatggactctagagctca
tgtccattggttatcgacagcagtgttaacatggagggaattcataaagactatgtacgtctacctgacgaagtag
© 1998-2018