Dataset for CDS BCL-WAV of Organism Danio rerio

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|D2Y5Q2_BCLWAV-01 BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Danio rerio GN=BCL-WAV (length=600 residues).
atgggacggtcagacgacgctgtgattggtcgaggcctgaacagtccagatccactagtgcgtgaagcttttctgatggc
gtacgactacatcagctacgtgacagccaaaccaggcgtcccgttgtgtccggcaccttcccgtgcttccgctgccctgc
gccacgctggagacgagctgctgatccgcttcccgatcttctttcgccgctggccgagagttttccaggacgtgacggag
cacacggcctgccccacgctgctctccatcctggacgaacacttcgctcccacgaggcgcagggatctggcctggagcgc
cgtgctgtcggtgttcgttctggctggtcagctggctctgcactgccaggacaggggcatggaggacatcacgccgcaga
tacaggagtgtgtgggcagctacgtggagagggtcatctgccccgagatccgggacaaaggaggatggtcaggttttatc
tctcgctttggagaaaagcagaatcttgaagaccatgtggtaaaggtgtgttgctggtctctgctcctgctgtgtgttgg
catcttatcctatttcatatggacaagaagaaaaacctag
© 1998-2018