Dataset for CDS BAX-like of Organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A0R4IZP5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=675 residues).
atgaagggcatggagatgttgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttgatcgctctcccacgga
caaggagctcgtgtctcagtccaaagtgttgtgtagggattatattcactccagactgcaccgggctggaatcgggtggt
cgaaaccagaacacgggtctggaggaaccctggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
ctgcgtcccaacgtctaccgcaacgtagctcgacagctcaacatcacaatagcctctgagaatatcgtctctgatgcctt
tctggccgtcgctgctgaaatcttctccacagaatatagtcgaaaaggtttggaaaaacataagggtgtaacatggggga
agattgtgtctctgtatgcagtggctggagctctagctgtggactgtgttcggcatggacatccagcaatggtgcacact
atcgtcgactgcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagagaggaggctgggcggacataac
aaagtgtgtcgtcagtacagaccccagtttccactctcactggctagtaacggccgcctgcgcctgcggtcactacctta
aggctgtggttttctacctgctgagagagaaatga
>gnl|bcl2dbcds|A0A0R4IZP5_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=663 residues).
atgaagggcatggagatgttgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttgatcgctctcccacgga
caaggagctcgtgtctcagtccaaagtgttgtgtagggattatattcactccagactgcaccgggctggaatcgggtggt
cgaaaccagaacacgggtctggaggaaccctggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
ctgcgtcccaacgtctaccgcaacgtagctcgacagctcaacatcacaatagcctctgagaatatcgtctctgatgcctt
tctggccgtcgctgctgaaatcttctccacaggctctgtctgtttctttacaggtgtaacatgggggaagattgtgtctc
tgtatgcagtggctggagctctagctgtggactgtgttcggcatggacatccagcaatggtgcacactatcgtcgactgc
atgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagagaggaggctgggcggacataacaaagtgtgtcgt
cagtacagaccccagtttccactctcactggctagtaacggccgcctgcgcctgcggtcactaccttaaggctgtggttt
tctacctgctgagagagaaatga
>gnl|bcl2dbcds|A9JSY8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=615 residues).
atggcagatgggaagaatggagagacgacagacgaaaatgagttaaagggagctacagggggtgaagatgtggtagatga
tgcgatcattgagcagagtgctgttctacttagagggtacgttattcagcaagctactatagatgatccaaacattcacg
tgagtcacgagactctcggaggaagacctcaggatgaagaggatcctcaaatcaaagaagttgtagatcagcttttgaag
atagctgacgaccttaacaagaatgctgagcttcaacatctcatcagcaccgttcagtcaaactgcgctcaggacgtctt
catgactgtggccagaagcatttttgatgatggcattaactggggacgtgtggtggctctgtttcacctcgcttataggc
tcattttccaggctctgactcagaaccactttgagattatcaagaacatcattagctggtttttacagtttatgaagaaa
cacatttctgcctggatcagacagcaaggaggatgggagggcattttccgcagcatgacgagatggcgcacagtgtctac
catcgcagcagtggcgttcattgtagctgttgtttactggagaagaactcgctag
>gnl|bcl2dbcds|B0S7M3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=645 residues).
atgcgggacatgaacgtgttcgcgcgctcctccgtgctcgccgccgagatgatggatgtgtttgatcgcactcacacgga
gaaagagctcgtctttcagtccaaggagctgtgtagagacttcattcactccaggatcacgagagaaggactgagttggt
caaaagtcgagctggacctgccagaaccgcgcggagttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaa
ctggagtgcatgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgtatcggtggaagctgtggtttc
agatgcatttctctcggtagcaacagaagtcatagccatgggaatcacatggggtaaagtggtggccatctacgctgtag
ctgccgggcttgcggtggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggacagtctgggagagttt
gtgcggagaagtctcgtgccatggctcaaaaagagaggaggatgggttgacattttaaaatgtgtggtgaacatggactc
tagagctcatgtccattggttatcgacagcagtgttaacatggagggaattcataaagactatgtacgtctacctgacga
agtag
>gnl|bcl2dbcds|B2GRX5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=636 residues).
atgaacgtgttcgcgcgctcctccgtgctcgccgccgagatgattgatgtgtttgatcgcactcacacggagaaagagct
cgtctttcagtccaaggagctgtgtagagacttcattcactccaggatcacgagagaaggactgagttggtcaaaagtcg
agctggacctgccagaaccgcgcggagttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgtatcggtggaagctgtggtttcagatgcatt
tctctcggtagcaacagaagtcatagccatgggaatcacatggggtaaagtggtggccatctacgctgtagctgccgggc
ttgcggtggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggacagtctgggagagtttgtgcggaga
agtctcgtgccatggctcaaaaagagaggaggatgggttgacattttaaaatgtgtggtaaacatggactctagagctca
tgtccattggttatcgacagcagtgttaacatggagggaattcataaagactatgtacgtctacctgacgaagtag
>gnl|bcl2dbcds|D2Y5Q2_BCLWAV-01 BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Danio rerio GN=BCL-WAV (length=600 residues).
atgggacggtcagacgacgctgtgattggtcgaggcctgaacagtccagatccactagtgcgtgaagcttttctgatggc
gtacgactacatcagctacgtgacagccaaaccaggcgtcccgttgtgtccggcaccttcccgtgcttccgctgccctgc
gccacgctggagacgagctgctgatccgcttcccgatcttctttcgccgctggccgagagttttccaggacgtgacggag
cacacggcctgccccacgctgctctccatcctggacgaacacttcgctcccacgaggcgcagggatctggcctggagcgc
cgtgctgtcggtgttcgttctggctggtcagctggctctgcactgccaggacaggggcatggaggacatcacgccgcaga
tacaggagtgtgtgggcagctacgtggagagggtcatctgccccgagatccgggacaaaggaggatggtcaggttttatc
tctcgctttggagaaaagcagaatcttgaagaccatgtggtaaaggtgtgttgctggtctctgctcctgctgtgtgttgg
catcttatcctatttcatatggacaagaagaaaaacctag
>gnl|bcl2dbcds|I3ITC2_BAX-04 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=348 residues).
atggaagcgctgttggattacgttgttcgtattggcagtggcaatgatcagacacttgatgcaggatctgcagttctctt
taacttcatctttgaatggcttcatcaacacttagacaaagaagctgaaataacctgttggttacaaaataatttgggta
ttgttgagaaaagtgaccccagccataaagatgcaatcgagtgtatggtgaggattgcaaatgaaatggaaggaaatgaa
gaactacaagggatgttaaatagcgctctcttaaatccaactctagaacactacatccttgtggtcaatgggaccttctc
tgatgtgacattaagctggggctgctga
>gnl|bcl2dbcds|I3ITC2_BAX-03 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=594 residues).
atggaagcgctgttggattacgttgttcgtattggcagtggcaatgatcagacacttgatgcaggatctgcagttctctt
taacttcatctttgaatggcttcatcaacacttagacaaagaagctgaaataacctgttggttacaaaataatttgggta
ttgttgagaaaagtgaccccagccataaagatgcaatcgagtgtatggtgaggattgcaaatgaaatggaaggaaatgaa
gaactacaagggatgttaaatagcgctctcttaaatccaactctagaacactacatccttgtggtcaatgggaccttctc
tgatgtgacattaagctggggtagtgttgtggcacttttttatgttgcatgtcggtttgttgttaaggctgctgaaatca
actctgttgacttggtcagaagcattataaactggactatgccttttattagaaagacctgcattttaacctggatcagg
gaacagggtggatggggcgcaatccgctcatatttcgggacccccacctggcagacagttggagttttccttgctggagt
tcttactgtaggcttggtgctctacaaaatgtga
>gnl|bcl2dbcds|Q08BX9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=615 residues).
atggcagatgggaagaatggagagacgacagacgaaaatgagttaaagggagctacaggtggtgaagatgtggtagacga
tgcgatcattgagcagagtgctgttctacttagagggtacgttattcagcaagctactatagatgatccaaacattcacg
tgagtcacgagactctcggaggaagacctcaggatgaagaggatcctcaaatcaaagaagttgtagatcagcttttgaag
atagctgacgaccttaacaagaatgctgagcttcaacatctcatcagcaccgttcagtcaaactgcgctcaggacgtctt
catgactgtggccagaagcatttttgatgatggcattaactggggacgtgtggtggctctgtttcacctcgcttataggc
tcattttccaggctctgactcagaaccacttggagattatcaagaacatcattagctggtttttacagttcatgaagaaa
cacatttctgcctggatcagacagcaaggaggatgggagggcattttccgcagcatgacgagatggcgcacagtgtctac
catcgcagcagtggcgttcattgtagctgttgtttactggagaagaactcgctag
>gnl|bcl2dbcds|Q6DC66_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=666 residues).
atggagatgttgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttgatcgctctcccacggacaaggagct
cgtgtctcagtccaaagtgttgtgtagggattatattcactccagactgcaccgggctggaatcgggtggtcgaaaccag
aacacgggtctggaggaaccctggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtacctgcgtccc
aacgtgtaccgcaacgtagctcgacagctcaacatcacaatagcctctgagaatatcgtctctgatgcctttctggccgt
cgctgctgaaatcttctccacagaatatagtcgaaaaggtttggaaaaacataagggtgtaacatgggggaagattgtgt
ctctgtatgcagtggctggagctctagctgtggactgtgttcggaatggacatccagcaatggtgcacactatcgtcgac
tgcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagagaggaggctgggcggacataacaaagtgtgt
cgtcagtacagaccccagtttccactctcactggctagtaacggccgcctgcgcctgcggtcactaccttaaggctgtgg
ttttctacctgctgagagagaaatga
>gnl|bcl2dbcds|Q7T381_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Danio rerio GN=BOK (length=636 residues).
atgaacgtgttcgcgcgctcctccgtgctcgccgccgagatgattgatgtgtttgatcgcactcacacggagaaagagct
cgtctttcagtccaaggagctgtgtagagacttcattcactccaggatcacgagagaaggactgagttggtcaaaagtcg
agctggacctgccagaaccgcgcggagttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgtatcggtggaagctgtggtttcagatgcatt
tctctcggtagcaacagaagtcatagccatgggaatcacatggggtaaagtggtggccatctacgctgtagctgccgggc
ttgcggtggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggacagtctgggagagtttgtgcggaga
agtctcgtgccatggctcaaaaagagaggaggatgggttgacattttaaaatgtgtggtaaacatggactctagagctca
tgtccattggttatcgacagcagtgttaacatggagggaattcataaagactatgtacgtctacctgacgaagtag
>gnl|bcl2dbcds|Q9I9N4_BAX-03 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=579 residues).
atggcagcgccgtcgggtggaggcgatacgggcagtggcaatgaccagatacttgacttgggagctgcacttctcaacaa
ctttgtgtatgagcgtgttcgtcggcatggcgacagggatgctgaagtgacccggagtcagcttgggggcgtggagctgt
gtgaccccagccataaacgcctcgcgcagtgtttgcagcagatcggagatgagctggatggaaatgcgcagctgcaaagc
atgttaaacaactctaatcttcagccgactcaagatgtcttcatcagagtggcccgtgagatcttctctgatggcaagtt
caactggggaagagttgtggcgcttttctactttgcctgtcgccttgtcatcaaggctatttcaaccagggttcctgaca
tcatcagaaccatcataagctggacgatgtcctacattcaggagcacgtcattaactggatcagggaacagggtggatgg
gacggaatccgcagttattttggcacccccacctggcagacagtcggagttttcctcgctggagttatcaccacagcatt
ggtgattcgcaaaatgtga
© 1998-2018