Dataset for CDS BAX of Organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A9JSY8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=615 residues).
atggcagatgggaagaatggagagacgacagacgaaaatgagttaaagggagctacagggggtgaagatgtggtagatga
tgcgatcattgagcagagtgctgttctacttagagggtacgttattcagcaagctactatagatgatccaaacattcacg
tgagtcacgagactctcggaggaagacctcaggatgaagaggatcctcaaatcaaagaagttgtagatcagcttttgaag
atagctgacgaccttaacaagaatgctgagcttcaacatctcatcagcaccgttcagtcaaactgcgctcaggacgtctt
catgactgtggccagaagcatttttgatgatggcattaactggggacgtgtggtggctctgtttcacctcgcttataggc
tcattttccaggctctgactcagaaccactttgagattatcaagaacatcattagctggtttttacagtttatgaagaaa
cacatttctgcctggatcagacagcaaggaggatgggagggcattttccgcagcatgacgagatggcgcacagtgtctac
catcgcagcagtggcgttcattgtagctgttgtttactggagaagaactcgctag
>gnl|bcl2dbcds|I3ITC2_BAX-04 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=348 residues).
atggaagcgctgttggattacgttgttcgtattggcagtggcaatgatcagacacttgatgcaggatctgcagttctctt
taacttcatctttgaatggcttcatcaacacttagacaaagaagctgaaataacctgttggttacaaaataatttgggta
ttgttgagaaaagtgaccccagccataaagatgcaatcgagtgtatggtgaggattgcaaatgaaatggaaggaaatgaa
gaactacaagggatgttaaatagcgctctcttaaatccaactctagaacactacatccttgtggtcaatgggaccttctc
tgatgtgacattaagctggggctgctga
>gnl|bcl2dbcds|I3ITC2_BAX-03 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=594 residues).
atggaagcgctgttggattacgttgttcgtattggcagtggcaatgatcagacacttgatgcaggatctgcagttctctt
taacttcatctttgaatggcttcatcaacacttagacaaagaagctgaaataacctgttggttacaaaataatttgggta
ttgttgagaaaagtgaccccagccataaagatgcaatcgagtgtatggtgaggattgcaaatgaaatggaaggaaatgaa
gaactacaagggatgttaaatagcgctctcttaaatccaactctagaacactacatccttgtggtcaatgggaccttctc
tgatgtgacattaagctggggtagtgttgtggcacttttttatgttgcatgtcggtttgttgttaaggctgctgaaatca
actctgttgacttggtcagaagcattataaactggactatgccttttattagaaagacctgcattttaacctggatcagg
gaacagggtggatggggcgcaatccgctcatatttcgggacccccacctggcagacagttggagttttccttgctggagt
tcttactgtaggcttggtgctctacaaaatgtga
>gnl|bcl2dbcds|Q08BX9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=615 residues).
atggcagatgggaagaatggagagacgacagacgaaaatgagttaaagggagctacaggtggtgaagatgtggtagacga
tgcgatcattgagcagagtgctgttctacttagagggtacgttattcagcaagctactatagatgatccaaacattcacg
tgagtcacgagactctcggaggaagacctcaggatgaagaggatcctcaaatcaaagaagttgtagatcagcttttgaag
atagctgacgaccttaacaagaatgctgagcttcaacatctcatcagcaccgttcagtcaaactgcgctcaggacgtctt
catgactgtggccagaagcatttttgatgatggcattaactggggacgtgtggtggctctgtttcacctcgcttataggc
tcattttccaggctctgactcagaaccacttggagattatcaagaacatcattagctggtttttacagttcatgaagaaa
cacatttctgcctggatcagacagcaaggaggatgggagggcattttccgcagcatgacgagatggcgcacagtgtctac
catcgcagcagtggcgttcattgtagctgttgtttactggagaagaactcgctag
>gnl|bcl2dbcds|Q9I9N4_BAX-03 BCL2-associated X gene OS=[Eukaryota] Danio rerio GN=BAX (length=579 residues).
atggcagcgccgtcgggtggaggcgatacgggcagtggcaatgaccagatacttgacttgggagctgcacttctcaacaa
ctttgtgtatgagcgtgttcgtcggcatggcgacagggatgctgaagtgacccggagtcagcttgggggcgtggagctgt
gtgaccccagccataaacgcctcgcgcagtgtttgcagcagatcggagatgagctggatggaaatgcgcagctgcaaagc
atgttaaacaactctaatcttcagccgactcaagatgtcttcatcagagtggcccgtgagatcttctctgatggcaagtt
caactggggaagagttgtggcgcttttctactttgcctgtcgccttgtcatcaaggctatttcaaccagggttcctgaca
tcatcagaaccatcataagctggacgatgtcctacattcaggagcacgtcattaactggatcagggaacagggtggatgg
gacggaatccgcagttattttggcacccccacctggcagacagtcggagttttcctcgctggagttatcaccacagcatt
ggtgattcgcaaaatgtga
© 1998-2018