Dataset for CDS Unclassified of Organism Cyprinodon variegatus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A3Q2CZ97_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus (length=393 residues).
gatgatcccatcttggagcaaggagtggtggtgctcagggggtacgtggtagagcgtataaacacggaggaccccgaccg
ccatgtggtctctgaggacctgggaggaaggccgcatgaactggacgacccggaagtgaaggaagtggtggatcagctgt
tgaaaatagcagatgacctgaatagaaacgctctgaccaccaaccacctggagaacatccggatggtgaccagctgggtc
cttcaggtgatcagagagctgctttacccctggctggtgcagcagggaggatgggttggcgtgatccaaagcttctcccg
atggaggactgccatcgttgctgcgtcggttgttgtcatagcaacatttgtttactacagatcgaaacgctga
>gnl|bcl2dbcds|A0A3Q2CZ97_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus (length=444 residues).
ggagtggtggtgctcagggggtacgtggtagagcgtataaacacggaggaccccgaccgccatgtggtctctgaggacct
gggaggaaggccgcatgaactggacgacccggaagtgaaggaagtggtggatcagctgttgaaaatagcagatgacctga
atagaaacgcagagttccagcggaatatttgtattaaccatacatggaaactgttttatggggcccccaggaacttaggg
gctctgaccaccaaccacctggagaacatccggatggtgaccagctgggtccttcaggtgatcagagagctgctttaccc
ctggctggtgcagcagggaggatgggttggcgtgatccaaagcttctcccgatggaggactgccatcgttgctgcgtcgg
ttgttgtcatagcaacatttgtttactacagatcgaaacgctga
>gnl|bcl2dbcds|A0A3Q2CZ97_uncBAX-03 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus (length=429 residues).
ggagtggtggtgctcagggggtacgtggtagagcgtataaacacggaggaccccgaccgccatgtggtctctgaggacct
gggaggaaggccgcatgaactggacgacccggaagtgaaggaagtggtggatcagctgttgaaaatagcagatgacctga
atagaaacgcagagttccagcgtcagtttaacttatcatacctgggaaaacttgagatacatcgagctctgaccaccaac
cacctggagaacatccggatggtgaccagctgggtccttcaggtgatcagagagctgctttacccctggctggtgcagca
gggaggatgggttggcgtgatccaaagcttctcccgatggaggactgccatcgttgctgcgtcggttgttgtcatagcaa
catttgtttactacagatcgaaacgctga
© 1998-2019