Dataset for CDS BAX-like of Organism Cyprinodon variegatus

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A3Q2DRF3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinodon variegatus GN=BOK (length=642 residues).
atggatgttctccggcggtcctctatgtttgcctcagaggtgctggatgtctttgaccgatcagtgaccgagaaagagct
ggtgtctcagtccaaagcactttgcagagactacatcctttccaggctcaaccagaatggattaggatggtccaaaactg
aacttaacttctctccctctaatgcagcagtcgctgaagtgtctcaggtgcttctttgtcttggcgatgagttggaaagc
atacagcccactctgtacaggaacgtggcaaggcagcttaacatttccgttgccatggagaatgttgtttcagatgcctt
cctcagcgtggcaacggagatctttgcagcaggtattacatggggtaaagtggtagccatgtatgcggtagctggagccc
tggcagtagactgtgtcagacagggacaccccacaacagtgcacattatagtggacagtcttggacagtttgtccgtaag
tttctcgtccattggctgaagaggaaaggaggatgggcagaaatcatgaagtgcgtggtgaaaatggactgcacccctga
acggccttggctatcatctgtcatggattccttcaaatattttctcactacagtgtatgtctacatcatgaaggagcagt
ga
>gnl|bcl2dbcds|A0A3Q2DXF3_BAX-03 BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus GN=BAX (length=597 residues).
tctttcatacaaacattacagtgttgtggtgctagttacctacaaatgtgtcttatctgtactctctactctctccaaat
gttttctagtttcgtcgtgaagtggattcagcgacatgcattaagtaaggtgccgatcctccaggaagcgttgggtgtaa
cagctctctgtgacccacagcagcagaaagtctctgatgcctttcaggttgttgcggatgaagtggatggagaaggaggg
attaaaaagctaatagaggttccatcattcactccctcaaaggaagtgtttgtgaaaattgtccgcgaactcttttccga
tggggagatcaactggggcagggtggttaccgtcttctgctttgccggcatgtttgtcttgaaagctcatgaaagcaaaa
tatgtgagttaatcaaaaccataatcagctggatcatagactttttccgagaaaaggtgcttggctggataaaggagcaa
ggcggctgggagggaattttttcctacgtcggcattcccatgtggcaatttttggggatttttctggctggggttgtcac
cacccttgtcgtcgtccacaagatgagggccgaatga
>gnl|bcl2dbcds|A0A3Q2DXF3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus GN=BAX (length=537 residues).
atgctagcatcacatactagccaagaaagggtctctagcattttatgcttaaacaatacatctattttcgtcgtgaagtg
gattcagcgacatgcattaagtaaggtgccgatcctccaggaagcgttgggtgtaacagctctctgtgacccacagcagc
agaaagtctctgatgcctttcaggttgttgcggatgaagttccatcattcactccctcaaaggaagtgtttgtgaaaatt
gtccgcgaactcttttccgatggggagatcaactggggcagggtggttaccgtcttctgctttgccggcatgtttgtctt
gaaagctcatgaaagcaaaatatgtgagttaatcaaaaccataatcagctggatcatagactttttccgagaaaaggtgc
ttggctggataaaggagcaaggcggctgggagggaattttttcctacgtcggcattcccatgtggcaatttttggggatt
tttctggctggggttgtcaccacccttgtcgtcgtccacaagatgagggccgaatga
>gnl|bcl2dbcds|A0A3Q2DXF3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus GN=BAX (length=522 residues).
atgtgtcttatctgtactctctactctctccaaatgttttctagtttcgtcgtgaagtggattcagcgacatgcattaag
taaggtgccgatcctccaggaagcgttgggtgtaacagctctctgtgacccacagcagcagaaagtctctgatgcctttc
aggttgttgcggatgaagttccatcattcactccctcaaaggaagtgtttgtgaaaattgtccgcgaactcttttccgat
ggggagatcaactggggcagggtggttaccgtcttctgctttgccggcatgtttgtcttgaaagctcatgaaagcaaaat
atgtgagttaatcaaaaccataatcagctggatcatagactttttccgagaaaaggtgcttggctggataaaggagcaag
gcggctgggagggaattttttcctacgtcggcattcccatgtggcaatttttggggatttttctggctggggttgtcacc
acccttcaaaccaagaagttaatgggaggatttacagagtaa
>gnl|bcl2dbcds|A0A3Q2E537_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyprinodon variegatus GN=BAX (length=576 residues).
atggcagaaggaggtggaggtgaccaagggaatccggttgatcctatggtggaagttggagctgtgttgctaaaggattt
catctaccagcggattcggcggcacgtagacggcgatactgatgtgacccgggaacagttgggtgccacggagctatgtg
acccaaaccatttaaagctcgctcagtgtctccagcagattggagatgagctggatggaaacatggagctgcagaggatg
atagaggactctgccctcaaaccaacaaaagatgtcttcatgaaagtggcacttcagatcttttctgatggtagattcaa
ctggggtcgagtggttgcgctgttctactttgcctgtcgactcgtcataaaagcccttatcaccaaaattccagaaatca
tcagaactataatcaactggaccatagactacatccgggatcatgtgatcaactggatcagagagcaaggtggctgggag
ggtattcgctcctacttcggcacgcctacatggcagacggtgggtgtcttcctggctggagttcttgccactgtttttgt
catgcgcaagatgtga
>gnl|bcl2dbcds|A0A3Q2EB70_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinodon variegatus GN=BOK (length=633 residues).
atggagatgctgcggcgctcctccgtgtttgcggccgaggtgtttgaccgatcccccaccgacaaggagctggtgtccca
ggctaaagctctgtgcagagactacatccactccaggctccaccgcgccggggtcggctggtccaaagctgagcagggaa
gcgcggcggcggggggaaagctggcggaggtgtccgcggtggtccagtggctgggcgatgagttggagtacctccgcccc
aacgtctaccgcaatgtcgctcgccagctgaacatctcggtggcgatagagggcgtggtgtccgacgccttcatggccat
cgctgcagacatcttctcaacaggcgtgacgtgggggaaggtggtctccttgtacgctgtggcgggagctctggcggtgg
actgcgtacgccatggtcatccagctatggtccacaccatcgtcgactgcatgggggagttcgtccgcaagagtctgact
ccatggttgaagaagagaggcggctgggcggatataacgaagtgcgtggtgaacaccagcccccccttctactcccactg
gttggtgtctgccgtctttgccttcggacactacctgaaagctgtggtgttgtacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A3Q2EB70_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinodon variegatus GN=BOK (length=1269 residues).
atggttgaagaagagaggcggctggctacattaacgtacgacacacttcggttcggagagtttgaagattttcctgagac
ctcggagcctgtgtggatcttggggaaagagtacaacgcgctcacagagaaagatgagattctgtcggacgtcacatcac
gactgtggttcacatacaggaaaaacttcccgcccatcggaggaacggggccgacgtcggacacagggtgggggtgtatg
ttacggtgcggccagatgattctgggggaggcgctgatgtgtagacacctaggcagggactggagatgggccagagagca
gaaacaaagagaagaatacatcagcattctcaacgccttcattgataaaaaagacagctactattccatccatcaaatcg
gtgagctgtcatcctcagagctctgcgctctgcctctcactggtttccattcaactgtttttgtggtctctgctgcagcc
cagatgggagtgggagagggaaagccgatcggacagtggtacggacccaacaccgtcgcccaggtcctgaagaagctggc
tgtgtttgatacgtggagcaggttagtcgtccacgtggcgatggacaacactgtgatcatcgaggagatcaagcgtcttt
gcatgccgtggctggacctagcaggtgaagcggagggcgaggcggaggtgaacggctgcctggaaggagcgtgcgctctg
gctgaggaggaggcggctctatggaggccgctggtcctgctcatcccgctcaggctgggcctgagtgacattaacgaggc
ctacattgaaaccctgaagcaatgcttcatgctgcctcagtccctgggtgttattggggggaaacccaacagtgcccatt
acttcattggttatgtcggagaggagctgatctatttagacccgcacaccacgcagccggcggtggagcccagcgaagac
ggccaggtccccgatgaaacctaccactgtcagcacccgccctgccgcatgcacatctgtgagctggacccgtccatcgc
agcgggcttcttctgccaaacagaggatgactttgatgactggtgtctgcgcatccgaaggttgtcctgcaagaaaggcg
gcctgcccatgtttgagttggtagacagtcagcccgtccacatggtcagcgtcgacgccctgaaccttactcctgatttc
tcagactcggaccgactggaacggttctttgattccgaggatgaagagtttgaaatcttgtccctgtaa
>gnl|bcl2dbcds|A0A3Q2EB70_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinodon variegatus GN=BOK (length=633 residues).
atggagatgctgcggcgctcctccgtgtttgcggccgaggtgtttgaccgatcccccaccgacaaggagctggtgtccca
ggctaaagctctgtgcagagactacatccactccaggctccaccgcgccggggtcggctggtccaaagctgagcagggaa
gcgcggcggcggggggaaagctggcggaggtgtccgcggtggtccagtggctgggcgatgagttggagtacctccgcccc
aacgtctaccgcaatgtcgctcgccagctgaacatctcggtggcgatagagggcgtggtgtccgacgccttcatggccat
cgctgcagacatcttctcaacaggcgtgacgtgggggaaggtggtctccttgtacgctgtggcgggagctctggcggtgg
actgcgtacgccatggtcatccagctatggtccacaccatcgtcgactgcatgggggagttcgtccgcaagagtctgact
ccatggttgaagaagagaggcggctgggcggatataacgaagtgcgtggtgaacaccagcccccccttctactcccactg
gttggtgtctgccgtctttgccttcggacactacctgaaagctgtggtgttgtacctcctcagggagaagtga
© 1998-2019