Dataset for CDS Unclassified of Organism Cynoglossus semilaevis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P8W1D5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cynoglossus semilaevis (length=603 residues).
atgtcgtgtgaaggaaatggcatgtccgatgaaagaatagggacggcgctcatcaaagtcgtcatcgaagaggaactgaa
ggatgttccttcagaggatgtcccgcctcttaccccgctggttgtagatgttacaagtgagcaggagaggaagatagtga
gccagttgggcgtcatgtgtcggatcattggtgacaggatgcgagatgataccgagttccaggatgccatcgatggagtg
gtgcaatgcagcggctttaaatgggaccgttttaagcaagtggctgaaaaagtttttgagcaaggcatcacctgggagag
gatcgccgtgctcttctacgtggcaggaaaactagcactgaagatggtggaggttcacctgcctcagtcagtgcgagaga
tcctgatgtggactgtggacttcttcaaaaataaccttttgagctggattcgggaacatggaggatggatcaacagtttc
tcctcgttagccgtggcctccatgccgggtgtttcctccattagctccttcacagcctttatcctcatcttcatcactgg
tgtcactctgggaagcttcatcacctggagactgaccagatga
© 1998-2019