Dataset for CDS BAX-like of Organism Cynoglossus semilaevis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3P8VGS5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cynoglossus semilaevis GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgttcgaccgctcgcccaccgacaaggagctggtgtccca
ggcgaaagctctgtgccgagactacatcaactcaaggctgaatcgtgtcggtatgggctggactagccctgaacacggac
tagcttcatcctcagggacaatgagagagatttcatcggttttgctgtggttaggcgatgagctggaatacctccgaccc
aatgtttatcgtaacgtagcgcggcagctaaatatcactgttgcctcggagagtgtggtctctgacgccttcctggctgt
ggcggctgacattttctctacaggtataacatggggaaaggtggtgtccttgtacgcagtggcgggggccttggcagtgg
attgtgttcgccatggtcatccttcaatcgtccataccattgtggactgcatgggagagtttgtccgcaagagtctgacc
tcctggttaaaaaaaagaggcggctggatggatgtcactaagtgtgtggtcaatactgaccccagattcagctctcactg
gttggtgatggctgcctgtacctttggacattatgtgaagaccattgtgttgtacctgctcagggagaagtga
>gnl|bcl2dbcds|A0A3P8WH41_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cynoglossus semilaevis GN=BOK (length=642 residues).
atggaggttctgcggaggtcttctgtgtttgcagcagaggtcctggatgtgtttgaccgctcactgactgagaaggacct
agtgtcccagtccaaagccctttgcagagactacattctgttcagactcaaccagaatgggctgggatggtccaaatctg
agctcaacctcgtgccctccaatgcagcactcgctgaagtgtcttcagttcttctgtgcctcggcgacgagctggagtgt
ttacagccatctttgtacaggaacgtggcacggcagctcagcatctctgttgccatggagaacatggtctccgatgcgtt
cattggtgtgtcaacagaaatctttgctacaggtataacctggggtaaagttgtggccatgtatgctgtagctgcagccc
tggccgtggactgtgtcagacaagaccgggcggccaacgtcaacatcatagtgcagagtctgggacagtttgtccgcaag
ttcctggtttcctggctgaagagacggggaggatggggtgatatcacgaaatgtgtggtaaagaaagattttcccccaga
acagaactggttaacctcggtcatggagtccctgaagtactttcttaccacagtgtacgtctacatcatgaaagagccat
ga
>gnl|bcl2dbcds|A0A3P8X0F2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAX (length=579 residues).
atggcagcgcacccgggaggagacgatgacggtaccaacagggatcaattactggaattaggacgtattctgttgaagga
tttcatctatgaacgtgttcaacggaatagagacagcaatgctgttgtgaccaggtcacagcttggagcaggggagctct
gtgacccaaaccacaagaagctggctcagtgtcttcagcaaattggagacgagctcgatggaaatgtagaactccaaagg
atgatagagaactcttcactcagtcccaccagagaagtgtttatgagagtagcctacgagatcttttcagacgggaaatt
caactggggccgagtggtagctctgttctacttcgcctgtcgactcgtcatcaaagctctggtgacccaagtccctgaca
tcatcagaaccatcatcaactggaccgttgattaccttcgtgaaaatgtaatcaactggatcatggagcaaggtggctgg
gagggcattcgttcctactttggcactcccacatggcagacggtgggagttttcttggctggcgttctcaccactgtcat
tgtcatacggaaaatgtga
© 1998-2019