Dataset for CDS BAX of Organism Cynoglossus semilaevis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P8X0F2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAX (length=579 residues).
atggcagcgcacccgggaggagacgatgacggtaccaacagggatcaattactggaattaggacgtattctgttgaagga
tttcatctatgaacgtgttcaacggaatagagacagcaatgctgttgtgaccaggtcacagcttggagcaggggagctct
gtgacccaaaccacaagaagctggctcagtgtcttcagcaaattggagacgagctcgatggaaatgtagaactccaaagg
atgatagagaactcttcactcagtcccaccagagaagtgtttatgagagtagcctacgagatcttttcagacgggaaatt
caactggggccgagtggtagctctgttctacttcgcctgtcgactcgtcatcaaagctctggtgacccaagtccctgaca
tcatcagaaccatcatcaactggaccgttgattaccttcgtgaaaatgtaatcaactggatcatggagcaaggtggctgg
gagggcattcgttcctactttggcactcccacatggcagacggtgggagttttcttggctggcgttctcaccactgtcat
tgtcatacggaaaatgtga
© 1998-2019