Dataset for CDS Unclassified of Organism Ctenopharyngodon idella

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0M3U1E0_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Ctenopharyngodon idella (length=618 residues).
atggcttgcgaagtctcgcaggatgatcagattggagaagcactcctcatcagggtggtaagacatgaggtgatgagcgt
ggcagccgaaggaaatgcagccccaccagcccttccagaagatcaaccaataagcaacagccaggaccagatgcttgttc
aacagttggcggagaccattaaagtgattggtgataggctcgatcaggataaaacatttaatgacatgattgatggctta
gtaaaagtggctgataaaagcagtttctggaaacttgtggaaaaggttttcacagatggccagatcaactgggggagaat
tatagtgctgttctattcagttggaaagctgtctgcaaagatggtcctcgcacgcttacccagaattgtctcagatattc
tgaccttatgtctggattactttaggagaaatctgttggaatggattcgcaaagtgggaggatggatgcacagtatccct
gcactggcctgtttctcctttgagcaattttctggttcttcactaagaaaatattttccctattttggagccatgttttc
cttcacctgtggcttattgttaggtggcttcatcatcacgagacttcaaaaaagctaa
© 1998-2018