Dataset for CDS BAX of Organism Ctenopharyngodon idella

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0M5LPU0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ctenopharyngodon idella GN=BAX (length=579 residues).
atggcagcgccgtcgggtggaggcgatacgggcattggcaatgaccagatacttgctttgggttctgcacttctcaataa
cttcatctatgagcgggttcgtcgccatggagatggtgatgctgaagtaacccgggatcagttgggtggcgttgagctgt
gtgaccccagccataaacgtcttgcgcagtgtttgcagcagatcggagatgagctggatggaaatatgcagctgcaaagg
atgttaaatgactctgctcttcaaccgactcaagatgtcttcatgcgagtggcccgcgagatcttctctgatgggaagtt
caactggggcagggtggtggcgcttttctactttgcgtgccggcttgtcatcaaggctatttcaaccaagattcctgaca
tcattagaaccatcattagctggactatgtcctacattcaggaacatgttatcaactggatcagggaacagggtggatgg
gagggaatccgctcttattttgggacccccacatggcaaaccatcggggttttcctggcaggagttctcaccacagtagt
ggtgatccgcaagatgtga
© 1998-2018