Dataset for CDS BAX of Organism Cricetulus griseus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A1E3K3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cricetulus griseus GN=BAX (length=579 residues).
atggacgggtcgggggagcagctcggaggcggcgggcccaccagctctgagcagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagctgggaggatggccggggatacacctgagctgaccttggagcagccaccccaggatc
cgtctaccaagaagttgagcgagtgcctcaggcgaattggagatgagctggacagcaacatggagctgcagaggatgatt
gctaatgtggatactaactccccacgagaggtcttcttccgtgtggcagctgacatgtttgctgatggcaacttcaactg
gggccgggttgttgcccttttctactttgctagcaaactggtgctcaaggccctgtgtaccaaagtgcccgagctaatca
gaaccatcatgggctggacactggacttcctccgagagcggctgcttgtctggatccaagaccagggtggctgggatggc
ctcctctcatacttcgggacccccacctggcagacagtgactatctttgtggctggagtcctcactgcctcactcacgat
ctggaagaacatgggctga
© 1998-2018