Dataset for CDS BAX of Organism Crassostrea hongkongensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0C5DGQ6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Crassostrea hongkongensis GN=BAX (length=624 residues).
atgacatcgtctgacagctttcgaccattcgtgaaagaaccctcaggtgtgacccggcagctcagtaaggatgaggtggg
gcagcaggctcgagttcttctcctcaaccagttcatacaggacagactggccactgagagaagtgaagagcaagtgttgc
atatggaagatttacaagaccctggcacacccacaggtcctccactggaatatgtgcgagaaattggccgagctttacgt
tgcataggagatgagctggatagaaatgaacagattcagaacctgtgtgaccaagtaaacccaagtgcaaaccatgaaac
attcttcaatgttgccaacagtttctttgctgatggtgtttacaactggggcagagtgggatgtctattctactttgcct
acaaaatggcagtaaaggccttgagtaaaatcaatttgatcagatctatagtgaactgggtggtgaactttatcacagat
tatgtggctggctggatcatagatagaggcggatgggatgccatcatagaatattttgggaccccacaaaatcagttttt
tggagtcgtcggcctaggattaacagtttgtgctggcctctaccttttgaaggcgctcaaataa
© 1998-2018