Dataset for CDS BAX of Organism Crassostrea gigas

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|K1RL21_BAX-01 BCL2-associated X gene OS=[Eukaryota] Crassostrea gigas GN=BAX (length=462 residues).
atggaggatttacaagaccccggcacacccacaggtcctccactggaatatgttcgagaaattggcagagctttacgttg
cataggagatgagctagatagaaatgaacaaattcagaacctggttgaccaagtaaccccaagtgcaaaccatgaaactt
tcttcaatgtggccaacagtttcttttctgatggtgtttacaactggggcagagtgggatgtctattctactttgcctac
aaaatggcagtaaaggccttgagtaaaattaatttgatcagatctatagtgaactgggtggtgaactttatcacagacta
cgtggccggctggatcatagatcgagggggatgggatgccatcatagaatactttgggaccccacagaatcagttttttg
gagtcgtcggcctaggaataacagtttgtgctggcctttacctttggaaggcactcaaataa
© 1998-2018