Dataset for CDS Unclassified of Organism Common bottlenose dolphin gammaherpesvirus 1 strain Sarasota

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1Z1NED3_uncBAX-01 Putative BCL2-associated X gene OS=[Viruses] Common bottlenose dolphin gammaherpesvirus 1 strain Sarasota (length=609 residues).
atgctgcccgatgaccagagcggcgggcttccggaggggcagccggcgccggagaacggtgccccggggaacgctccacc
gacgccccggagtgaccacaattcattttacgcggatagcctccgggaaacgtccaccgtgctgagcaacgttatgacgg
cggtgttgaaccccagcctacatgtgcggcatctgaccgcctctgagctgctcctgatgaaactcaccagggaatgcatc
aacgacaactgcttcaagctgactaacatcgtgcttcagatgcgcgtggagaacaccgacaactactatcccattgtcat
gaaaatagtagtggatagctacgtggacggcaacatgaattgggggagactctgcgccaccatggccttcgtgtgcgtgt
ttatgcgccacctcgtcggcagcacccaggaaacgatcgacatcttcgcccatctgctgtccagcttctacatgaataaa
cacttaaagtggctggtcgatgtcaacggcctctccgcgggggcgcgaagccattttccgatatcctggacgtggtgcag
ttgccagctgcttttttacaggctcatgctccgccgctcccgcaaataa
© 1998-2018