Dataset for CDS BAX of Organism Colobus angolensis palliatus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A2K5JHM2_BAX-02 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcactg
cctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5JHM2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatgggcggggagacgcccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcactgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5JHM2_BAX-05 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=591 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatgggcggggagacgcccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtcccttggtgccctctccccatcttcggatcatcaga
tgtggtctataacgcgtttccttacgtgtct
>gnl|bcl2dbcds|A0A2K5JHM2_BAX-04 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=555 residues).
atggacgggtccggggagcagcccagaggcgggggagtgacaccccgttctgattctgcaccctcactccatccccactc
taggcgaatgggcggggagacgcccgagctggccctggacccagtgcctcaggatgcgtccaccaagaggctgagcgagt
gtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccc
cgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
ctttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacactgg
acttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgccc
acgtggcagaccgtgaccatcttggtggctggagtactcactgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5JHM2_BAX-03 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=597 residues).
atggacgggtccggggagcagcccagaggcggggtttcatccaggatcgagcagggcgaatggctggccctggacccagt
gcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgc
agaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggc
aacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcc
cgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtg
gttgggggctgcccctggctgagtcgctgaagcgactgctgtccctgtctccaggacggcctcctctcctactttgggac
gcccacgtggcagaccgtgaccatcttggtggctggagtactcactgcctcgctcaccatctggaagaagatgggctgag
gcccccagctgccttgaactgtgtttttcctccataa
© 1998-2018