Dataset for CDS BAX of Organism Colobus angolensis palliatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K5JHH5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcactg
cctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5JHH5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatgggcggggagacgcccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcactgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2019